All Questions

Tagged with
Filter by
Sorted by
Tagged with
0
votes
2answers
56 views

How to find more than one space and replace it with one space?

I want to find repeated spaces (more than one) and replace them with one space. I tried: sed -e 's/ []+/ /g' myfile.txt > myfile2.txt This resulted in an empty file. Why? and how to achieve my ...
0
votes
1answer
30 views

How to search for a newline that is not preceeded by } and remove it

I want to use sed to search for line breaks that are not preceded by }. The regex for identifying theses cases is: [^}]$ . What I want to say: If the line ended without } then remove the new line. ...
0
votes
1answer
44 views

How to capture two regex

In this command, I want to extract strings that are like *.com or *.net, where * is not a dot. I wrote this: grep -P -E '^[^.]+\.com$ |^[^.]+\.net$' example.csv I get this error: grep: conflicting ...
0
votes
4answers
117 views

Removing lines whose first column is duplicated

I have a file where strings are separated by a special string (not a comma or delimiter) e.g. <vvv>. I want to check if all strings in the first field are unique. If duplicate rows for the same ...
0
votes
0answers
35 views

How to change the newline position [duplicate]

I have a file that contains string in each line. I used this file as an input in a program that reads them automatically. The program seem to not be able to read the strings correctly. I tried to ...
0
votes
1answer
38 views

How to extract the first column in a file with multi-character delimeter?

I have a file in which I use a string like <xxxxx> to separate the fields. This was a choice to avoid problems with the comma separated fields and other types of single characters due to the ...
3
votes
4answers
410 views

How to remove trailing forward slash

For each line in my file, if the line ends with / I want to remove it. How to do this? My attempt: sed -e "s/$\/$//" myfile.txt > myfile_noslash.txt Did not work.
-1
votes
1answer
34 views

Search for a string in lots files in a directory, if found, save the file name and line

I have several files, with different names. no specific format for them. But all are .txt. For example: example.txt flower.txt abc.com.txt They are in the same directory. I want to search for a ...
-4
votes
2answers
55 views

Finding specific string in XML file and storing in another file [closed]

Text in input file is like this <title> <band height="21" isSplitAllowed="true" > <staticText> <reportElement x="1" y="1" ...
-2
votes
1answer
37 views

Unable to search a string using more pager

I opened a file using the more pager,i was trying to find a string in this file using / as shown in the figure below,but it is saying that pattern not found even though the string i have searched is ...
2
votes
1answer
559 views

How to grep '$$$$$'? [duplicate]

I want to check the absence of the following sequence of characters $$$$$ (i.e., 5 dollar signs) in a json file using grep as it has been used instead of comma to separate fields and I need to make ...
1
vote
4answers
115 views

RegEx for matching strings in 2nd and 5th columns using grep

I have a file (test.txt) that contains string such as: name1,6.5.8.12,specs1,version1,['66.55.89.12'] name2,19.13.13.159,specs2,version2,['13.13.173.59'; '14.19.232.42'] name3,141.101.196.40,specs3,...
0
votes
2answers
61 views

How to check if first column's string of file1 exist in the file2?

I have two files, file1.txt contains strings separated by commas: 1.1.1.1,string1,comment1 7.7.7.7,string3,comment3 2.2.2.2,string2,comment2 88.88.88.88,string4,comment4 999.999,999,999,string5,...
3
votes
4answers
484 views

Extract addresses separated by semicolon and print each address in a line

I have a file with the following input. The numbers separated by dots represents addresses. Any number in address can be one or more digits as follows: [112.112.112.112;3.3.3.3;44.44.44.44] [6.6.6.6;...
0
votes
2answers
363 views

Searching for URLs with subdomains using grep

I have a file with content similar to: mail.google.com srv1.mail.google.com google.com facebook.com yahoo.com tt.twitter.com I want to search for lines with subdomains. I used this command: grep -e ...
6
votes
3answers
5k views

Search for special characters using grep

I want to search for the lines that contains any of the following characters: : / / ? # [ ] @ ! $ & ' ( ) * + , ; = %
1
vote
1answer
537 views

How to search for a pattern using grep?

I want to search a file to check for patterns like this: text1,text2,[1.2.3,3.4.5,6.7.8,etc] exist. The number of commas inside the square brackets is undefined. I tried the following command but it ...
0
votes
4answers
41 views

How to replace the line with an exact matching of a string

I have a file with this content: dskldfsd.com domain domain.com sub.domain.com domain.main.com anythinghere I want to delete the line which contains the word domain. Using grep, this command ...
2
votes
4answers
614 views

How to extract columns before and after a string ocurrence

I have a text file. That looks like: www.ac.com has address 6.1.1.146 www.ac.com is an alias for ac.com. www.ac.com is an alias for ac.com. www.ba.net is an alias for www-bn.gs.ba.com. www-bn.gs.ba....
0
votes
2answers
92 views

How to query all lines in a file that are NOT equal or suffix of any name in another file

I have two files file1 and file2. The two files contain names. One name in each line. I want to query all names in file2 that are not equal to or a suffix of name in file1. Note that the prefix is ...
-1
votes
2answers
2k views

grep to extract lines that contains full domain names from a file [closed]

I have a large file that contains domain names in the form of: domain.com sub.domain.com sub.domain.co.uk domain.co.uk I want to extract main domain names (no sub domains) with top level domain name ...
0
votes
1answer
99 views

Extracting lines that has match in the first column? [duplicate]

I have two files: file 1: a,txt1,v1 b,txt2,v2 c,txt3,v1 d,txt4,v2 file2: a,txt5,v2 b,txt6,v1 xc,txt7,v1 xd,txt8,v2 I want to refine the files. I only need the lines where the 1st column in file1 ...
0
votes
1answer
60 views

comparing 1st and 3rd column value in two files [closed]

I use Ubuntu 18 and have little experience with Linux commands. I have two files: file 1: a,txt1,v1 b,txt2,v2 c,txt3,v1 d,txt4,v2 file2: a,txt5,v2 b,txt6,v1 c,txt7,v1 d,txt8,v2 I want to print ...
1
vote
1answer
80 views

How to Replace a string by another in a text file

I would like to replace a given string in a text file into by another, but with one extra detail. Example: If the file content's is : Library Hello1 =============== any text here version: 0.1 ------...
-3
votes
2answers
484 views

Find and Extract Text inside Strings [closed]

I want to find text inside a string Pattern from a data file and extract them in a text list using shell or AppleScript. An example inside XML: node file="source_files/ (var1) .mp3" Another example ...
0
votes
1answer
65 views

Is there a variant of “strings” that only matches null-terminated C strings?

I'm up against a situation that seems like it must already have an implemented solution somewhere, but I'm having a tough time finding one. I'm looking for something that functions more or less ...
4
votes
2answers
102 views

Extract Sub-Directory Path from Partially Known Directory

Lets say I've got the following directory structure: base/ | +-- app | | | +-- main | | | +-- sub | | | +-- first | | | | | +-- tib1.ear | ...
0
votes
1answer
4k views

Replacing a Part of URL String in a Linux File With Another String

I have an HTML file on a Linux server that contains a long list of links. I am trying to edit this file as follows. Find original occurrences of this type: http://www.test.org/name Replace them with: ...
4
votes
2answers
12k views

How to extract lines from a text file that contains strings from a list in another file? [duplicate]

I have a file containing population information for a bunch of towns. I have another file that is a list of the names of a subset of those towns. I want to select the population information from the ...
4
votes
2answers
113 views

How to use the results of “file” (Name of Creating Application: Microsoft Word) to search for a specific string?

I am trying use the results of "file" which returns info about the file/s I specify. E.g. file *.doc 'all .doc extensions This then returns information about the file including "Name of Creating ...
2
votes
2answers
1k views

Identify sub-directories that do not contain a specific string in a specific file

I have a directory named dir1 which has about 800 sub-directories named disp-001, disp-002, ... disp-800. I need to find sub-directories that either do not contain a file stdout or if they do, that ...
2
votes
3answers
497 views

Find strings in file1, count occurrences in file2

I have file1.txt with string values such as New Drug Application Drug Product Dosing instructions I need to count how often these strings occur in file2.txt with data such as Regulatory New Drug ...
5
votes
2answers
2k views

Replace very long string in files recursively

I have a very long and complex string in many files and I want to remove/replace it recursively. The string contains many slashes, backslashes and spaces and any kind of special signs. How do I do ...
4
votes
4answers
25k views

Compare two text files and find matching lines

I have two files A and B. A looks like this (4 to 6 lines): GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT ...
2
votes
3answers
3k views

How to reverse-match a string in the Vim programming language?

I want to find the last index of any character in the [abc] set in the abcabc string but the search should start from the end of the string: " Returns the 0th index but I want the 5th. let a=match('...
3
votes
2answers
1k views

remove only specific text occurrences from string using sed

I have a text file that contains many rows of this sort of thing: /*[17:51:27][1 ms]*/ UPDATE `country` SET `region_id` = '4' WHERE `country_id` = '36'; Is there a way that I can use sed to remove ...
3
votes
2answers
6k views

How to remove error messages when searching recursively for a string?

I use find -type f -print0 | xargs -0 -n 10 grep -i searchstring to search recursively for a string. But it also gives me error messages like "permission denied". How can I avoid such error messages ...