All Questions

Filter by
Sorted by
Tagged with
0
votes
2answers
40 views

Extract match and everything before next match, do it for every match

I have a file with this structure: >Cluster 0 0 51aa, >MG00HS05:520:C8M1TACXX:3:1101:1428:2080/1... * 1 51aa, >MG00HS05:520:C8M1TACXX:3:1101:1658:2480/1... at 3:51:1:49/96.08% 2 ...
0
votes
2answers
47 views

Extracting lines to new files

Say I have a large CSV file with a header and several columns. For the purpose of this question I will consider a small file with just two columns. We can call it use_rep. user_id,rep 885,500K+ 22565,...
1
vote
1answer
42 views

Compare two text files, extract matching rows of file2 plus additional rows

have been mocking around with this too long and tried grep, join, awk but I cant get the parameters right. I need to get the command right. I have got two text files. cat file1 @ABC:11:ABC:1:...
2
votes
4answers
498 views

Parse all strings of specific length?

I've exported my email archive of 10 years which is very large. I want to parse all the text for any string that is 64 characters long in search of a bitcoin private key. How can I parse strings of ...
0
votes
4answers
52 views

How to extract word which has only numbers separated by 'dot'

From below lines abcd efgh ijhk lmn opqrs 9.0.8.2c tuv wxyz abcd efgh ijhk lmn opqrs 8.1.3.9b How to extract only 9.0.8.2c 8.1.3.9b
-2
votes
2answers
81 views

Find longest stretch of pattern from centre of sequence

How to calculate the longest consecutive pattern of C/T anywhere in sequence and longest consecutive pattern of C/T from centre CCCCTGTTGCCAAACAATGC TTTTCCCGCCTTTGGCCTAC ...
0
votes
1answer
43 views

For a given string(2 or 3 word) in a .txt file and print the whole line. [duplicate]

My .txt file contains these kind of content : The Law and Lawyers of Pickwick, by Frank Lockwood 21214 Frankenstein, by Mary Wollstonecraft 20 The first ...
0
votes
3answers
3k views

Grep for word stem and print only word (and not line)

I'm trying to print only a matching word that are found through a regular expression. Below, I want all the OPENSSL_NO_* options that are present in the source code: $ grep -IR OPENSSL_NO fuzz/asn1.c:...