awk - skip first line of record

Question

I searched but couldn't find a solution to my problem. I have a file containing strings of the letters A, T, C, and G (representing DNA sequences) as follows:

$ cat species_gene

>genus_1_species_1
TTGGATATTGAGTTACATACATATGATTTGGGAATGGAGAACCGAGATAAGACTGAAGATCAAGTCACAATTGATTGTGC
TAATGCTGTCAAGAAATACAATGTCGGCATCAAATGTGCAACTATTACTCCTGATGAAAATCGAGTTGAGGAGTTCAAGC

>tribe_1_species_1
CTGGATATAGAGTTGCACACATACGATCTGGGAATGGAAAACCGCGACAAGACTGATGACCAAGTCACAATCGATTGCGC
CAACGCGATTAAAAAATACAACGTTGGAATTAAGTGCGCGACCATCACTCCCGACGAGAAGAGAGTCGAGGAATTCAAGC

>species_2
CTTGATATTGAACTACACACCTATGATTTGGGAATGGAATACCGCGATAAAACTGATGACCAAGTCACAATTGACTGCGC
KAATGCTATTAAGAAATACAATGTTGGTATTAAGTGCGCTACCATAACTCCAGATGAAAAAAGAGTTGAAGAATTCAAAC

I would like to count the number of letters in the strings following the header >genus_1_species_1 until the next header. In this case, the length of the following strings, equal to 160:

TTGGATATTGAGTTACATACATATGATTTGGGAATGGAGAACCGAGATAAGACTGAAGATCAAGTCACAATTGATTGTGC
TAATGCTGTCAAGAAATACAATGTCGGCATCAAATGTGCAACTATTACTCCTGATGAAAATCGAGTTGAGGAGTTCAAGC

I would like to use awk and use > as the Record Separator and line-breaks as the Field Separators, and subsequently count the number of fields (i. e. lines), starting from the second line of the record. I used the following command:

$ awk 'BEGIN {RS=">"} NR==2 {print length}' species_gene

I obtained 180 (the number of characters of the first record). The output I'd like to get is 160 (the length of the first record, starting from the second line). I tried the following one to discard the header:

$ awk 'BEGIN {RS=">"; FS="\n"} NR==2 {if (NF!=1) {length}}' species_gene

I would be glad if someone could help me.

Answer 1

IMHO it would be mre natural to use the blank line as record separator. In this 'paragraph mode', awk includes newlines as field separators, so in your case each line of the record becomes a field. You can then remove the first field by assigning the empty string to it; this has a nice side effect of re-evaluating the whole record with the given output field separator: by setting this to the empty string as well, the remaining fields are concatenated. You can then simply print the length of the record.

awk 'BEGIN {RS="";OFS=""} NR==1 {$1=""; print length}' species_gene

Testing with your given input

$ awk 'BEGIN {RS="";OFS=""} NR==1 {$1=""; print length}' species_gene
160

Answer 2

length is not only a variable in Awk, but a function:

$ awk 'BEGIN {RS=">"} NR==2 {print length($2) + length($3)}' species_gene
160

That's it: add the lengths of the two fields, rather than using the length of the whole record.

Shorter:

$ awk 'BEGIN {RS=">"} NR==2 {print length($2 $3)}' species_gene
160

Equally long:

$ awk 'BEGIN {RS=">"} NR==2 && $0 = length($2 $3)' species_gene
160

Answer 3

A possible minor improvement over your improvement to steeldriver’s answer:

awk -vRS=">" -vOFS="" '$1=="genus_1_species_1" {$1=""; print length;}' species_gene

The -vRS=">" is equivalent to BEGIN {RS=">"}, and likewise with the -vOFS="".  My contribution is that this version lets you specify the header of the record whose length, so you don’t have to count records.