Adding a character to every other text line

Question

I have a huge (ca. 20G) text file which contains millions of passages (a.k.a. paragraphs) with headers. Headers and paragraphs are always one line each, e.g.,

Sunshine
This is a sunny day.
Darkness
A cave is a dark place.

What I try to come up with is a terminal command which goes through the text and adds a '>' in front of every header, i.e., every odd-numbered line (lines 1, 3, 5, …), e.g.,

>Sunshine
This is a sunny day.
>Darkness
A cave is a dark place.

Any ideas?

If this is relevant: the above text was just an example. Most of the headers are MD5s, followed by a DNA sequence ('paragraph'), e.g.,

0002ebd9ca12d6b69dfc3066356fc299
CATTAACCATTGGATACCTTCGGGTATATCCCATCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGTCACACACTGTGGGCTATGCCTGCATGTGCCTGCCAGAGGACCA

… which I'm trying to convert to

>0002ebd9ca12d6b69dfc3066356fc299
CATTAACCATTGGATACCTTCGGGTATATCCCATCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTGGTCACACACTGTGGGCTATGCCTGCATGTGCCTGCCAGAGGACCA

Answer 1

To edit every other (a.k.a. every second) line, starting with the first, with GNU sed, do

sed '1~2s/^/>/' your_file

This will write the modified file to the standard output.  I.e., if you type just the above, the modified file will display on the screen.  You can put this into a new file by redirecting the output with a >; e.g.,

sed '1~2s/^/>/' your_file > your_new_file

or, if you want to modify your existing file, use -i:

sed -i '1~2s/^/>/' your_file

Answer 2

POSIXly:

sed 's/^/>/;n' < file.in > file.out

Answer 3

Another POSIX answer:

paste -d'>\n' /dev/null - - <infile

It gets:

>Sunshine
This is a sunny day.
>Darkness
A cave is a dark place.

Answer 4

sed '1,${s/^/>/g;n;n;n}' filename

Testing

cat filename
'Sunshine

'This is a sunny day.

'Darkness

'A cave is a dark place

'Sunshine

'This is a sunny day.

'Darkness

'A cave is a dark place

'Sunshine

'This is a sunny day.

'Darkness

'A cave is a dark place

After I run the command, I get the output as,

sed '1,${s/^/>/g;n;n;n}' new
>'Sunshine

'This is a sunny day.

>'Darkness

'A cave is a dark place

>'Sunshine

'This is a sunny day.

>'Darkness

'A cave is a dark place

>'Sunshine

'This is a sunny day.

>'Darkness

'A cave is a dark place

Answer 5

With awk you could try something like,

awk 'NR % 4 == 1 {sub(/^/,">")} {print}' filename

References

https://stackoverflow.com/questions/2099471/add-a-prefix-string-to-beginning-of-each-line

Answer 6

With no blank lines between each line and no ' character at the start:

$ awk '{print ((NR%2)? ">":"") $0}' passages.txt

gives:

>Sunshine
This is a sunny day.
>Darkness
A cave is a dark place.

Also, going by your responses to all the answers here, your input file isn't single lines with a Line Feed character at the end (\n). It might be worth checking it's source.

Answer 7

You can use Vim in Ex mode:

ex -sc '%s/\v(.*\n){2}/> &/|x' file

1. % select all lines

2. s substitute

3. \v turn on magic

4. x save and close