We’re rewarding the question askers & reputations are being recalculated! Read more.
3 deleted 42 characters in body; edited tags
source | link

Can you suggest me how I can combine.

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

>1
 
AAATTTTGGGGCCC
 
>2
 
ACCCCGGGTTT
 
..........
 
>10000
 
ATGCCCCCCCCCC

Output:

>1
 
AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC

Can you suggest me how I can combine.

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

>1
 
AAATTTTGGGGCCC
 
>2
 
ACCCCGGGTTT
 
..........
 
>10000
 
ATGCCCCCCCCCC

Output:

>1
 
AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC

Can you suggest me how I can combine.

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

>1
AAATTTTGGGGCCC
>2
ACCCCGGGTTT
..........
>10000
ATGCCCCCCCCCC

Output:

>1
AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC
2 added 51 characters in body
source | link

canCan you suggest me how iI can combine  .

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

1

AAATTTTGGGGCCC

2

ACCCCGGGTTT

..........

10000

ATGCCCCCCCCCC

1

>1

AAATTTTGGGGCCC

>2

ACCCCGGGTTT

..........

>10000

ATGCCCCCCCCCC

AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCCOutput:

please suggest

>1

AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC

can you suggest me how i can combine  

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

1

AAATTTTGGGGCCC

2

ACCCCGGGTTT

..........

10000

ATGCCCCCCCCCC

1

AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC

please suggest

Can you suggest me how I can combine.

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

>1

AAATTTTGGGGCCC

>2

ACCCCGGGTTT

..........

>10000

ATGCCCCCCCCCC

Output:

>1

AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC
1
source | link

how to concatenate a file with multiple header into one

can you suggest me how i can combine

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

1

AAATTTTGGGGCCC

2

ACCCCGGGTTT

..........

10000

ATGCCCCCCCCCC

1

AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC

please suggest