0
votes
0answers
6 views

Is it possible to run fbi inside tmux if the tmux if running in a virtual tty?

I have already looked at this question and the solution works insofar as I can get an image displayed in my virtual console. However, if I first launch a tmux inside the virtual console, and then try ...
0
votes
0answers
7 views

Reading from /dev/tty

How do I read what is being typed on a different virtual terminal? For example, I was trying to read from /dev/tty0: I did cat < /dev/tty0 and read < /dev/tty0 But nothing is being sent ...
1
vote
1answer
32 views

Am I hitting a race condition in bash?

I have a script which compares the output of a command with the output of the same command as it was ran previously, it works most of the time, but every now and then it doesn't work as expected. ...
0
votes
1answer
19 views

assigning read/write privileges for a folder to a user in CentOS 7

I am logged into a CentOS 7 server as root. I created a folder /somefolder. I want someusername to be able to write to that folder via scp from a remote computer. What command should I run so that ...
0
votes
0answers
4 views

Configure pam_mount to prompt for password

I have configured my Ubuntu system to mount a cifs share using pam_mount and a credentials file (the credentials to access the cifs share are different to those I use on my Linux machine). I'd like to ...
2
votes
1answer
13 views

How can I remove packages untracked by pacman I installed from source?

Hey so the question pretty much says it all, ive installed the irc client quassel and I want to get rid of it now but i dont know how to do so with pacman because i installed it from the source code, ...
0
votes
1answer
18 views

CentOS 7 add new user with root privileges

I am reading this tutorial, and trying to create a new user with root privileges and then block root access via ssh in a CentOS 7 server. The problem is that the new user is blocked from doing root ...
0
votes
0answers
18 views

Setting up a highly available Mail service with Postfix and ISCSI

in an academic project these days we've got to set up a highly available Mail service with ISCSI and Postfix... For now i have a highly available ISCSI SAN and also a highly available Postfix server, ...
1
vote
2answers
29 views

Shell Script - number of minutes

Shell How can I write a shell script, using only shell features (and the date command), to output the number of minutes that have elapsed in the current day?
1
vote
1answer
7 views

IPv6 Zone ID in /etc/hosts

I'd like to setup a static hostname for an IPv6 address on local network. It seems, however, that /etc/hosts won't accept a zone ID - when I append a zone ID to an IPv6 address, it acts as if the host ...
2
votes
1answer
15 views

what does Xserver access control mean

What meaning does Xserver access control have, when the Xserver is started with tcp disabled: /usr/bin/X11/X -nolisten tcp AFAIU, Xserver can be used to allow remote network connection. But, if it ...
1
vote
0answers
6 views

Connecting SSH and Git to gpg-agent

I'm running a YubiKey NEO with the OpenPGP applet to store my GPG keys on the smart card. I've stopped all other SSH and GPG agents manually by removing their startup entries (On elementary OS Luna, ...
1
vote
2answers
20 views

Count and list down + advanced features

I have a few questions: I have listed the number of lines in the files in /group/book/four/word, sorted by the number of lines they contain using $ wc -l /group/book/four/word/*|sort -n ...and ...
1
vote
0answers
15 views

Take the unknown contents of variable as literal in sed [duplicate]

I have two files: a.patterns contains patterns in a one per line way "`" "^" "<" "<(" "<)" "<[" "=" ">" "_;|^+*+?@" and b.data contains comma separated values. 1,1,0,"*",1 ...
1
vote
4answers
53 views

tab separation of the file

I have a file with seq likes this ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT ...
0
votes
0answers
13 views

Video Player That Shows Milliseconds

Is there a video player for Linux that shows the milliseconds of time elapsed? There's an extension for VLC, but according to comments at the link it doesn't work with newer versions.
1
vote
0answers
15 views

tracking directory permission changes

Permission of a certain directory named 11203 got changed twice bcoz of which the hosted app encountered some problems. When i used the command.. ausearch -i |grep chmod |grep 11203 I got the ...
1
vote
1answer
9 views

LDAP Authentication on OpenBSD

I'm trying to get an OpenBSD server to authenticate users using the same LDAP server the rest of my home network uses. While 'getent password' lists the users from the LDAP server as expected, I ...
0
votes
1answer
9 views

How do I suporess all email notification from cron for particular job?

I am scheduling the following shell script #!/bin/bash (echo open mailserver.nowhere.local 25; sleep 1; echo EHLO; echo quit)\ | telnet | grep "?Invalid command" if [ $? -eq 1 ]; then ...
0
votes
1answer
24 views

How much trouble will NVIDIA Optimus graphics switching cause my Linux installation?

I'm about to get a new laptop, and I want to dual-boot Windows and Linux on to it. I noticed that a lot of laptops you can buy come with Optimus graphics switching installed. I like the idea of ...
1
vote
1answer
15 views

YouCompleteMe vim extension: How to jump to next error?

Is there any way when using the YouCompleteMe vim extension to jump to the next point in the file with an error? I find myself just scrolling through the page until I find the error highlight, but ...
0
votes
0answers
7 views

ErrorDocument CGI not executing, source displayed

On Apache HTTP server 2.2, the ErrorDocument has a PHP CGI script in my configuration which shows a nice message and reacts to multiple error codes and shows additional information for each. This ...
0
votes
1answer
22 views

Backing up Linux server to Windows domain

I'm maintaining a small Linux workstation/server in a Windows-domain-based environment. Apart from being in the same network, the Linux computer is not connected to the domain. Until now, I'm using a ...
3
votes
1answer
24 views

Retrieve X11 window ID of a just-launched GUI-program

I want to retrieve the X id of GUI programs I launch in background, in order to work on their windows properties. I've been so far using this workaround: myprogram & sleep 1 winID=$(wmctrl -l | ...
2
votes
1answer
15 views

gnome classic terminal mouse double click selection

I am running ubuntu 12.04.5 lts. When I do a mouse double click selection I would like to select only a current word. For example in a line like: /home/xx/asdf right now the whole line gets ...
1
vote
2answers
53 views

How do I expect 'echo -e “? \c”'?

I'm an absolute newbie to the UNIX world and have been asked to write a script that interacts with another one - but I'm stuck. The script that I interact with echos the following and I need to send a ...
3
votes
2answers
50 views

Replace uppercase to lowercase except first letter of each word in specific line

I want to replace names that I received in uppercase letters only. The names are mixed with other information which should stay as it is. AUTH: at the beginning of the line identifies it as a line ...
-2
votes
4answers
37 views

How to ignore the lines starts with # using grep / awk

cat /etc/oratab #test1:/opt/oracle/app/oracle/product/11.2.0.4:N +ASM2:/grid/oracle/app/oracle/product/11.2.0.4:N # line added by Agent test2:/opt/oracle/app/oracle/product/11.2.0.4:N ...
1
vote
0answers
7 views

Installing generic-logos and generic-release on Fedora

The guidelines for Fedora remixes suggest to replaces packages fedora-logos, fedora-release, and fedora-release-notes with the generic-* equivalents when making a remix. Most tutorials online focus on ...
0
votes
0answers
11 views

xfrm and xfrm gc stats

Are there any stats related to the XFRM and XFRM garbage collector? I am unfortunately running on a ubuntu 10.04 and cannot upgrade. /proc/net/xfrm_stat is not available. I am chasing some ipsec ...
-1
votes
0answers
12 views

QtSoap Network transport error (99): Error creating SSL context () Linux Mint [migrated]

I have a problem with connection to a web service with ssl protocol. I was trying to connect with specyfied WebService using open libraries QtSoap. Since now I have been searching any solution of ...
1
vote
1answer
22 views

Remove/Delete Attachments from email server (IMAP)

I have a rather large quantity of emails on my mail server (IMAP) which contain attachments (PDF's, etc.) These attachments waste space--my HDD space on server is limited by my hosting company--and I ...
1
vote
0answers
14 views

Print to a printer attached to the user's terminal in CentOS

I have a server with SCO Unix 505 in which we run an application in Foxbase. I've just installed CentOS 5.5 and made my Foxbase application work in Centos. The problem is that in SCO Unix foxbase ...
0
votes
1answer
26 views

Make own graphical server [on hold]

I had experience to work with framebuffer and found it pretty well to make own graphical applications. But the problem is that framebuffer is too slow. My goal: 1) Make a new tty which will work for ...
3
votes
3answers
169 views

awk manipulation of file

I have a big file in this format, whose first few lines I am showing you including the header. gene c1 c2 c3 c4 c5 c6 c7 c8 G1*1 0 0 0 0 0 0 0 0 G2*2 0 0 0 0 1 ...
1
vote
1answer
53 views

How to run “&” operation sequentially

From my script I am running following commands: SCRIPT_1="ksh -x script1.sh & ksh -x script2.sh"; SCRIPT_2="ksh -x script3.sh & ksh -x script4.sh"; eval $SCRIPT_1; sleep 20s; eval ...
0
votes
1answer
31 views

How to copy a file with scp via another server

I have three machines. The local machine L, Server1 A, Server2 B. L is able to connect to A A is able to connect to B L is not able to connect to B I want to copy a file from L to B without ...
1
vote
1answer
27 views

Why is laptop screen called eDP1?

In my new laptop, using i915 and the intel driver of Xorg, the laptop screen is called eDP1 in Randr $ xrandr eDP1 connected 1024x768+0+0 (normal left inverted right x axis y axis) 277mm x 156mm ...
1
vote
0answers
21 views

A modern, easily configurable DE [on hold]

I am looking for a linux desktop environment with modern look and feel and can be configured programmably (or has the capability of easily exporting and importing configuration) Does it exist?
3
votes
2answers
32 views

Is there a way to run sudo without running another unneccessary command?

I wanted to run two sudo commands, piping the output from one to the other. However, when I haven't entered my password for sudo recently, it prompts me for the password. The pipes and two sudos seem ...
0
votes
0answers
9 views

bootable usb creator without default bootloader

I want a program (a linux command is more preferable) to create a bootable usb drive but all the programs which I have seen have a default bootloader which they install but I want the bootloader in ...
4
votes
3answers
329 views

How can I start a process with any name which does nothing?

I want to start a process that does nothing but is still running. Say I start a process called sadhadxk, and when I run pgrep -x "sadhadxk" I will get the PID number back, like any normal process ...
1
vote
1answer
27 views

using bash script to sort text in a file

I would like to sort the output of multipath -ll into a csv type of file using bash script. For example # multipath -ll would give the following output 360060e80056fc30000006fc30000513c dm-41 ...
1
vote
0answers
6 views

Custom global keybindings in cinnamon via gsettings

I am trying to setup some keyboard shortcuts for cinnamon: gsettings set org.cinnamon.desktop.keybindings custom-list \ "['custom0', \ 'custom1', \ 'custom2', \ 'custom3', \ ...
1
vote
1answer
14 views

script to add users to otrs

Im looking for a fast way to import customer users into otrs (ticket system) I have an export from Active Directory with: firstname lastname password email username There is a script in the otrs/bin ...
1
vote
2answers
14 views

rsync a list of directories with absolute path in text file

I have a text file containing a list of directories with its absolute path $ cat DirectoriesToCopy.txt /data/Dir1 /data/Dir2 I want to use rsync to copy all these directories preserving its ...
2
votes
0answers
19 views

Linux Mint desktop displays different files from ls command

Background I'm running Linux Mint 17 Cinnamon. After a botched attempt at migrating my data to a NAS, I restored my data from an external USB. Problem Statement After restoring from backup, all my ...
-1
votes
1answer
48 views

Help with Grep , uniq and sort

can anybody help me understand this expression grep -oP "TYPE=\w+" | sort | uniq -c
0
votes
0answers
11 views

Install Lubuntu as 2nd OS on encrypted computer?

I have debian installed on my computer which is installed in a full encrypted disk. Having tried lubuntu in virtual box form and liking it, I want to try lubuntu out on the actual computer instead of ...
1
vote
0answers
17 views

“login -qf” as root results in “Login incorrect” error

I'm trying to install pow on an OS X machine.* Some of pow's components have to run as root, so part of the setup process involves running an installation script with sudo. The problem is, this setup ...

15 30 50 per page