The tag has no usage guidance.

learn more… | top users | synonyms

0
votes
1answer
632 views

How to add new line in text file in output from remote shell script using plink

From windows i am executing a remote shell script using putty plink cmd>plink.exe -ssh username@hostipd -pw gbG8qs4 /user/alice/listoffiles.sh > C:\log1.txt Shell script in remote server #! ...
0
votes
1answer
117 views

What does this “matching lines means”?

The grep manual says "By default, grep prints the matching lines.". What does this matching lines says. When I tried its prints the whole paragraph containing the pattern.
2
votes
2answers
810 views

view file containing DOS text (box-drawing characters, CRLF line terminators) and escape sequences

I have stumbled upon a strange text file in an archive of an old dos game downloaded from some abandonware site. The text file is named WHY_NOT.TXT. I assume the file is some sort of .NFO file from ...
1
vote
1answer
86 views

textutil convert PDF to txt producing garbled output

I am trying to convert PDF files to text files using textutil. I don't if there are special types of PDFs that can and cannot be converted. The files I am trying to convert are in a searchable ...
0
votes
1answer
74 views

How can I find and replace only in a range of columns?

I have a text file with 9267 lines. I want to find "A" with 5 spaces after it and replace it with "A" with 5 spaces before and after it on all lines, but only between columns 67 and 88. Text outside ...
2
votes
1answer
61 views

Continously writing terminal output to text file

I am running a small cli python app in terminal. It loops infinitely and outputs text to the terminal. I want to output the text to a file, and I can do that with the following command python [my cli ...
2
votes
5answers
294 views

Duplicate lines and make them unique?

I have the following structure of text lines: 3923 001 L05 LV,L05 RM 3923 002 L12 RA,L12 LA 3923 003 I06 ALL 3923 004 G04 RV,Z09 ALL but i would need this: 3923 001 L05 LV 3923 001 ...
2
votes
3answers
209 views

Transforming text to tabular form

I have a text file with the following structure: aaa bbb ccc ddd eee fff 1 2 3 4 5 6 1.1 1.2 1.3 1.4 1.5 1.6 ggg hhh iii jjj kkk lll 7 8 9 10 11 12 2.1 2.2 2.3 2.4 2.5 2.6 and I want the ...
1
vote
2answers
19k views

How to select, copy and paste some columns from different files and create one file from them?

I want to create and organize data in a file from a number of files by selecting parts of the columns of the given files. I have more than 10 file to copy the second, third and forth columns of each ...
1
vote
1answer
173 views

Special characters in a web feed

I am running a script to check my gmail from the command line and display the first 35 characters in the title. curl -u username:password --silent "https://mail.google.com/mail/feed/atom" | \ grep ...
0
votes
1answer
64 views

ArchLinux i3 font rendering issue on Chromium

The font on Chromium's menu items is off-centered as seen below: Only chromium has this issue (I've tested LibreOffice). The font used to be fine, but I believe I made a change somewhere that ...
4
votes
1answer
47 views

Gedit displays text, but cat tells a different story

I am trying to sort a dictionary from Grady Ward's Moby and have encountered a bit of a problem. When I open it in gedit, I get: abaca×N abaciscus×N abacist×N aback×v abacli×p Abaco×N abactinal×A ...
0
votes
0answers
19 views

Searching text data in Hebrew, Arabic or Aramaic

How can I search for a (sub-)string in a database that has several languages, including Hebrew? I am assuming that the text being right-to-left is a question of the presentation, but the logical ...
2
votes
2answers
125 views

add filename as text in the corner of an image file

I have a bunch of jpeg images. Say 001abcd.jpg, 002abcd.jpg, and so on. I want to capture the filename and add it as a text in the image itself in one corner. So the result would be, for example, the ...
11
votes
3answers
7k views

What is the purpose of -e in sed command?

I can't find any documentation about the sed -e switch, for simple replace, do I need it? e.g. sed 's/foo/bar/' VS sed -e 's/foo/bar/'
5
votes
2answers
2k views

Keyboard Shortcut To Send Text Strings To Program

How can I configure a shortcut key to send a text string to the current program? The purpose is to type common entries quicker (email address, street address, phone number, username, favorite quote, ...
0
votes
2answers
105 views

Print text between two patterns not containing a particular word

I wanted to print some text between two patterns which doesn't contain a particular word input text is HEADER asdf asd asd COW assd TAIL sdfsdfs HEADER asdf asd sdfsd DOG sdfsdfsdf TAIL sdfsdfs ...
0
votes
2answers
61 views

compare two files and fetch data

I have two files: File A sample >> AT5G46880.1|PACid:19669936 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- ...
4
votes
1answer
59 views

Print out unicode values of stdin?

I use od to print me the octal or hex of a file/stdin/string. This lets me see the ASCII, or UTF-8 encoded, values of my stdin. But we don't live in ASCIIland anymore. Is there any command that will ...
4
votes
1answer
56 views

How to convert ęąśćżńł TXT to PDF with enscript?

I have problem converting a file to PDF. I create the file with echo ęąśćżńł > text and convert: enscript -O text -o - | ps2pdf - out.pdf However, out.pdf has an encoding problem:
22
votes
4answers
32k views

How can I find out how many lines a text file contains without viewing it?

How can I find how many lines a text file contains without opening the file in an editor or a viewer application? Is there a handy Unix console command to see the number?
-1
votes
1answer
61 views

How to remove duplicate lines from file? [duplicate]

I have file for example 'a' aaa aaa bbb ccc ccc bbb ddd After executing uniq a c i get file 'c' aaa bbb ccc bbb ddd How to delete duplicate bbb lines?
-3
votes
2answers
69 views

match two files and filter out [duplicate]

I have two files file A >TCONS_00000075 gene=XLOC_000030 CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAGCGCTACGGTC ...
0
votes
5answers
221 views

grep to fetch whole line

I have a file like: Chr1 Cufflinks exon 7136 7944 . + . gene_id "XLOC_000001"; transcript_id "TCONS_00000003"; exon_number "5"; gene_name "LOC_Os01g01010"; oId ...
0
votes
1answer
29 views

text processing

I have two files. file A : Chr1 Cufflinks exon 2903 3268 . + . gene_id "XLOC_000001"; transcript_id "TCONS_00000002"; exon_number "1"; oId "CUFF.1.2"; tss_id "TSS1"; ...
3
votes
1answer
1k views

Remove Text from Active Programs in Panel

In the panel, how can I remove the text next to the icons of my active programs? All I want to show is the icon. Specifically, in the example below, I want to get rid of where it says "Disc...", ...
4
votes
4answers
199 views

Insert new lines with missing values (NA)

I would like to insert new lines in text files if there are missing values. I have for example the following text file (A.txt), for which line 5 is missing. In addition, as the file should have 12 ...
1
vote
2answers
194 views

Search only in plain text files that are not source code

I use following command to search for string ELF in plain text files under the current directory recursively: grep ELF -r . but it also searches in binary files (e.g. zip file, PDF file), and in ...
47
votes
4answers
9k views

Creating diagrams in ASCII

I am looking for a program which I can use to create ASCII diagrams such these: +---------+ | | +--------------+ | NFS |--+ | ...
1
vote
0answers
85 views

Text User Interface

I have been working on a shell script, and was wondering if I can put up a text user interface for the shell script. After some searching, I see few people suggest using "ncurses/curses". However the ...
3
votes
3answers
222 views

display filename followed by content without interaction

My program writes it state to few files every 30 seconds or so (overwrites) and I would like to look at them with the filenames displayed like "more" does. Like: $ echo 1234 > test00 $ echo 5678 ...
1
vote
2answers
121 views

Extract words instead of letters from pdf files?

I use less which uses pdftotext to extract text from pdf files, by less my.pdf. In this way, some words' letters are separated by spaces from a pdf file. CH APTE R 2 5 T E ST IN G WE B A P P ...
4
votes
2answers
1k views

Is there something like a lorem ipsum generator?

Is there something like a 'lorem ipsum generator'? I know it exists in Latex, and even in LibreOffice, but I'm looking for a terminal command. I would like to type something like loremipsum 10 ...
1
vote
1answer
217 views

change linux text console scrolling speed - without rebooting

Is there any way to change to the text console scrolling speed without rebooting? Currently using Fedora, but non-distribution-specific answers appreciated. ...
0
votes
2answers
61 views

How do I download a PDF, then output a chunk of text?

My city water bill is emailed to me every month as a link to the current PDF hosted on their server. So I can easily download this PDF any time I want. How do I take that PDF and extract my account ...
0
votes
1answer
116 views

Running Linux in text mode - blank diamonds instead of Chinese/Punjabi etc. characters

While in the text mode and using, for example, Chinese/Simplified or India/Punjabi locale I get blank diamond symbols in the console in place of the characters. I am running Xubuntu with ...
3
votes
1answer
285 views

How do I view cp1251 text file in UTF-8 console?

Attempt 1: $ less subs.srt "subs.srt" may be a binary file. See it anyway? <C8><F2><E0><EB><FC><FF><ED> ... Attempt 2: $ LANG=ru_RU.CP1251 less subs.srt ...
0
votes
1answer
65 views

Is there something similar to the Notepad++ session workflow?

Is tmux+vim/nano the closest thing to the Notepad++ workflow (in recent versions of Notepad++ that automatically save session state)? I really miss that, it was convenient to just dump text I copied ...
1
vote
1answer
595 views

Converting a UTF-8 file to ASCII (best-effort)

I have a file in UTF-8 that contains texts in multiple languages. A lot of it are people's names. I need to convert it to ASCII and I need the result to look as decent as possible. There are many ...
6
votes
2answers
2k views

How to convert UTF-8 txt files to all uppercase in bash?

I have some UTF-8 .txt files which I would like to convert to all uppercase. If it was just ASCII, I could use: tr [:lower:] [:upper:] But since I'm working with diacritics and stuff, it doesn't ...
5
votes
3answers
885 views

How to know if a text file is a subset of another

I am trying to find a way to predict if a text file is a subset of another.. For example: foo bar is a subset of foo bar pluto While: foo pluto and foo bar are not one a subset of each ...
1
vote
1answer
86 views

How to add searchable text to an image?

I need to add text to an image (original image can be jpg, gif, or bmp) file, how can I do it? I added the texts with shutter to an jpg and converted to pdf. Tesseract has not been able to turn the ...
4
votes
1answer
1k views

Determine the new line character in a text file?

given a text, is there a program that can detect what the new line character is, the Windows, Mac, or Linux one? Eg, the following text is shown by less memor:^M^Mis storage directly accessible ...
4
votes
2answers
54 views

More shell scripts than one in one text file?

I am learning shell scripting for my introductory UNIX course at my university, and I`m curious if is it possible to have more than one shell script in one text file. What I mean by that is, for ...
1
vote
1answer
91 views

Using sed to align text starting from pattern to end of line

I have a text like this: LDX LEVEL LDA INITD015,X ; INITIAL ACTIVE SPRITES STA $D015 STA SAVED015 LDA INITXPOS,X ; INITIAL HERO X COORDINATE STA XPOS LDA ...
1
vote
2answers
216 views

Extracting file name and string from multiple files

I have a lot of files (>100,000) from which I would like to extract a specific string and the filename itself. Files are organized like this: Filename: sequence.php?ID=gi|90022703|ref|YP_528530.1| ...
7
votes
2answers
386 views

Copy a long single-line text from a terminal with undesired change-line

locate ... | less outputs a long path, which is shown as several lines in the terminal, although it is actually a single line. I copy the path from the terminal by selecting the text with mouse and ...
3
votes
1answer
164 views

Preventing mid-word line breaks in a2ps

So I understand that a2ps is mostly for converting ASCII code to postscript for printing, but occasionally I like to print a .txt or .md file for school. Often, an entire sentence (or even a ...
0
votes
2answers
184 views

How to copy text from an image in a pdf file?

I can view a pdf image with text using the evince document viewer, however I cannot select the text in the image to copy and paste. How do I copy text from an image in a pdf file?
1
vote
3answers
156 views

cat a directories files apending the file name to the row of text and removing the header row? [closed]

How can I cat a directories files apending the file name to the row of text and removing the header row? So as to only have 1 header row in the all.txt file.