Manipulation of text by programs, scripts, etc.

learn more… | top users | synonyms

2
votes
3answers
386 views

How to count the number of words and print the lines that match exactly a given pattern?

I want to count the number of words and print the matched pattern lines which matches exactly with following pattern: abc-ERROR: The input File contains: # abc-ERROR: xyxxkkfgfr # def-Error: ...
0
votes
3answers
21 views

split lines and print it to new line for certain character

I need to split lines and print it to next line when pattern match. Like I have: ABC123xxx:: 2345 ABC345yyy:: 5678 ABC986zzz:: 7955 And I want it to print to new line when ABC pattern will come: ...
-4
votes
3answers
50 views

I need a command to filter the statements from a .txt file

I have a file with the following contents: select * from emp; select * from dept; selection end; I want to obtain this output: select * from emp; select * from dept; I tried by ...
3
votes
7answers
299 views

grep with continuation lines

How can I grep/awk/sed a file looking for some pattern, and print the entire line (including continuation lines if the matched line ends with \? File foo.txt contains: something whatever thisXXX ...
0
votes
2answers
31 views

Replacing string in HTML with value from lookup file

Situation: I have a source HTML file, with some values which must be completed with data from another file. Value that must be enriched is between a unique tag. ...
2
votes
2answers
69 views

How can I append a # in front of each line of a block of text?

This is part of my PHP Myadmin's configuration file: Alias /phpMyAdmin /usr/share/phpMyAdmin Alias /phpmyadmin /usr/share/phpMyAdmin <Directory /usr/share/phpMyAdmin/> AddDefaultCharset ...
-1
votes
4answers
45 views

How to filter the table names from .txt file [duplicate]

select * from emp; select * from dept; selection end; I want to obtain this output: select * from emp; select * from dept; I tried by using: awk '/select/{a=1} a; /;/{a=0}' ...
2
votes
2answers
83 views

pull out lines that contain 1 in 3rd column

I've got a text file with 633K lines all have 3 columns 768844 30050038638556 0 768892 30050018569904 1 768967 30050028970902 0 How do I pull out in a file those lines that have "1" in the ...
2
votes
2answers
58 views

Find (and strip) common initial whitespace from file/pipe

I am looking for a way to find and remove the common initial whitespace from a text stream or file. I do not want to remove all leading whitespace (that would be a simple sed 's/^[[:space:]]*//'). ...
7
votes
6answers
3k views

How to grep-inverse-match and exclude “before” and “after” lines

Consider a text file with the following entries: aaa bbb ccc ddd eee fff ggg hhh iii Given a pattern (e.g. fff), I would like to grep the file above to get in the output: all_lines except ...
2
votes
4answers
4k views

Error: ambiguous redirect while transferring output to command

Output to redirect in script: 511@ubuntu:~/Unix/test$ ls -ltr |awk '{print $9}' default.txt dfah.txt fruit.txt fruit_prices.txt dfh.txt header.txt testfile.txt topoutput.txt Script written on shell ...
1
vote
1answer
35 views

convert hexadecimal to binary

I have a text file with lines (each of 631 characters) consisting of 16 hexadecimal numbers 0,1,2,...,9,A,B,...,F. I would like to replace each number with the corresponding 4 bits of 0 and 1, i.e. 0 ...
1
vote
3answers
35 views

Elegant way of counting how many times patterns from a file occur in another file

Imagine that we have two for example files. The first file is filled with unique names of employees created by combining the first two characters of the first name and the last 2 characters of the ...
0
votes
1answer
50 views

Only one line break in fasta file

I have a fasta file like: grep -A 7 -B 4 COSN229024 wrong.fasta: >COSN9627597 CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA >COSN8175610 CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT >COSN229024 ...
0
votes
1answer
82 views

seeking hints for correct escaping of sed commands WITHIN yaml

I am having a hard time finding the issue why following lines of "code" break my cloud-init config. Basically I am calling a son object as part of the DigitalOcean API which has a YAML format - I got ...
2
votes
3answers
619 views

Text to yaml conversion

I have a tab separated text file in this format: your-email your-order-id PayPal-transaction-id your-first-name your-second-name s@ess.com 12345 54321 sooky spooky t@tee.com 23456 ...
23
votes
7answers
28k views

how do I trim each line in bash?

I would like to remove all leading and trailing spaces and tabs from each line in an output. Is there a simple tool like trim I could pipe my output into?
-4
votes
2answers
57 views

linux : find a lastname that has 5 characters only in a text

Name, lastname, phone number .This is the text : Hace, Apoio, 703-2101 Yoliot, Apostolos, 4222-1124 Jenny,Thano,105-4122 Heriom,Koun, 510-4122 Dekon, Atolo, 502-2522 Feow, R,685-3431 I ...
3
votes
4answers
59 views

Find matches on adjacent lines

I want to find adjacent matching lines, e.g., if the pattern matches are $ grep -n pattern file1 file2 file3 file1:10: ... file2:100: ... file2:1000: ... file2:1001: ... file3:1: ... file3:123: ... ...
3
votes
1answer
65 views

Use awk as a stream editor

awk is the swiss army knife of text manipulation. If, however, I need to change small bits in a text, I reach out to sed generally. While it might be the best tool for the job, it is worth it to ...
2
votes
2answers
148 views

What's the fastest way to get n-th line of a text file [duplicate]

Given a file with m lines, how to get the n-th line. m can be smaller than n sometimes. I have tried: method1: sed -ne '10p' file.txt method2: sed -ne '10p' <file.txt method3: sed -ne '10{p;q;}' ...
4
votes
4answers
191 views

printing a block of text that matches a pattern

Using just shell script, how to search a text file and list all whole blocks of lines that has inside some text (simple grep criteria). The text file has blocks of lines separated by ...
-1
votes
1answer
75 views

How can I print a specific occurrence of a range pattern?

I am trying to extract several data fields out of somewhat peculiarly formatted strings. Each string has a format similar to the following (spaces added for emphasis): 1 abcd 2 1 efg 2 hij 3 ...
-1
votes
1answer
41 views

How to delete a specific paragraph in text file?

I have this following html file. {% load staticfiles %} <html> <head> <link rel="stylesheet" href="//maxcdn.bootstrapcdn.com/bootstrap/3.2.0/css/bootstrap.min.css"> ...
0
votes
2answers
93 views

Why does `read` not pick up all my vars?

My apologies for the very basic question, but can someone please help explain why the following does not print 3 2 1 6 5 4? echo '1 2 3 4 5 6' | while read a b c; do echo result: $c b a; done ...
-3
votes
1answer
45 views

Removing entire line with sed not working? [closed]

I have a line which looks like this: </File2>. I want to remove it using sed, but nothing I tried worked, I tried sed '/^<\/File2>$/d' so I thought maybe theres special characters at ...
1
vote
1answer
29 views

Join two files in a batch mode

I have many files with the following names: 0001mm.xyz , 0002mm.xyz , 0003mm.xyz ... 0001qm.xyz , 0002qm.xyz , 0003qm.xyz ... I want to join the contents of 0001mm.xyz and 0001qm.xyz ...
0
votes
2answers
58 views

format command output with variable and fixed space

How can I achieve this best maintaining the hierarchy on the left and aligning the size value on the right? Also, at the same time I'd like to round the size to one or two digits. I tried with printf ...
2
votes
1answer
26 views

grep a range of unix timestamps from a logfile

I have a logfile where every log event has a unix timestamp: 1460332800 event a 1460332999 event b 1460342800 event c 1460417039 event d Is there a clever unix-style way to grep all log events ...
6
votes
3answers
77 views

sed/awk subscript numbers in chemical formulas using markup tags

I have hundreds of text files that include chemical formulas together with narrative including numerical values. The formulas are always preceded by white spaces but can be followed by white spaces, ...
3
votes
1answer
127 views

Replace with sed until match in a line

I have to replace all "." characters before the "=" character in every line in a file. The lines are like this: one.two.three=something four.five=1 six.seven=127.0.0.1 ...
84
votes
5answers
68k views

Can grep output only specified groupings that match?

Say I have a file: # file: 'test.txt' foobar bash 1 bash foobar happy foobar I only want to know what words appear after "foobar", so I can use this regex: "foobar \(\w\+\)" The parenthesis ...
0
votes
1answer
33 views

Removing a pattern from a string and then storing the whole string into one index in an array

So I have a file of many fields which start with "Content:" like below... NOTE: The content goes over multiple lines Content:Wonderful time- even with the snow! What a great experience! From the ...
11
votes
7answers
807 views

Move first N lines of output to end without using temporary file

Imagine an output of a command like 44444 55555 11111 22222 33333 how can I yank the first N lines (first two in the example above) and append them at the end, but without using temp file (so only ...
4
votes
1answer
53 views

How Do I Remove Duplicate Words With Suffixes?

How do I compare a list of unsorted words of variable length and remove duplicate words that have a suffix? Example word list: iron curl curled railroad curler ...
1
vote
4answers
39 views

Bash file - find value from command output and keep as variable

I am trying to make a script that will conntect to a ups and get the battery value and store it in a variable. I have managed to connect to the ups and get infomation from it but I am strugling to ...
1
vote
1answer
23 views

Appending a value to all columns

I have a "simple" question yet I have not found an answer to it nor have I gotten my code to work. I have a bunch of columns, and I want to append the average of the last column to ALL columns. For ...
6
votes
4answers
565 views

Search for a string and print everything before and after within a range

I have this file: sometext1{ string1 } sometext2{ string2 string3 } sometext3{ string4 string5 string6 } I want to search this file for a specific string and print everything before this string ...
2
votes
4answers
3k views

Compare two .csv files

I have two files: 'file1' has employee ID numbers. 'file2' has the complete database of the employees. Here is what they look like: file1 123123 222333 file2 111222 Jones Sally 111333 Johnson ...
15
votes
12answers
794 views

Delete duplicate lines pairwise?

I encountered this use case today. It seems simple at first glance, but fiddling around with sort, uniq, sed and awk revealed that it's nontrivial. How can I delete all pairs of duplicate lines? In ...
3
votes
2answers
87 views

Search, insert, move and insert

I want to search each record (records are defined by blank lines) in a file for the pattern NAME#AAAA. If it matches, then insert an # in front of the record's AGE line and move that line to the top ...
1
vote
1answer
46 views

I want to search and replace a pattern

I want to search each record (records are defined by blank lines) in a file for the pattern NAME#AAAA. If it matches, then insert an # in front of the record's age and insert a line age NIL at the end ...
4
votes
4answers
387 views

Command for keeping the lines with a certain length in a file

I would like to keep the lines with exactly 639 characters in my .txt file. What is the command to do so?
0
votes
1answer
24 views

How to assign variables associated with list of ranges to another table with integers

I have a list of integers from 1 to 6k, and I have a list of ranges (start/stop) with a third value I'd like to assign to each integer within those ranges. The list of ranges might look like this, ...
1
vote
1answer
50 views

How to selectively remove columns and rows with bash?

I currently have a data set that looks like this: INPUT Hybridization REF TCGA-FA-8693-01A-11D-2399-05 TCGA-FA-8693-01A-11D-2399-05 TCGA-FA-8693-01A-11D-2399-05 ...
1
vote
4answers
178 views

print specific line from multiple files

I have a collection of 5000+ files and I just want to create a output.txt file which contain 27th line of all file along with filename. well I am noob at linux level so what i got from internet is to ...
1
vote
1answer
34 views

Capture text between curly braces in C preprocessed file

I'm working with a preprocessed C source file. I want to extract one function for additional processing. I can find the start of the particular function with: gcc -DNDEBUG -march=native -E source.c ...
38
votes
4answers
12k views

sort inplace - like sed --in-place - exists?

Am I blind or is there no option like --in-place for sort? In order to save results to the input file, sed uses -i (--in-place). Redirecting the output of sort to the input file sort < f > f ...
-3
votes
2answers
43 views

Extract a word from a line

Created a file employees: 1. Fred 2. Billy 1 3. Sally 1 4. Jim 2 5. Jane 2 6. Sue 3 7. Meg 3 Created a file “managers”: 1. Fred 2. Bill 3. Sally I want to print something like this: Fred ...
3
votes
4answers
274 views

how to make list of strings from file where this strings are in own line

I have file: xxx.lst with values: 111 222 333 I just need to make one line with: 111 222 333 into a variable or standard output.