Manipulation of text by programs, scripts, etc.

learn more… | top users | synonyms

1
vote
2answers
845 views

Replace string in the first column

I have a file which looks like: >TCONS_00000066_1 [3 - 170] >TCONS_00000066_2 [174 - 206] >TCONS_00000066_3 [2 - 223] >TCONS_00000066_4 [210 - 281] >...
2
votes
2answers
176 views

Using the sed command in Unix

how do you take one word from a file and change it to an absolute path? Basically I need to take one word from a unix file and change it to a absolute directory path in that file. The file name is ...
4
votes
5answers
405 views

Insert new lines with missing values (NA)

I would like to insert new lines in text files if there are missing values. I have for example the following text file (A.txt), for which line 5 is missing. In addition, as the file should have 12 ...
2
votes
1answer
257 views

Transform .csv into 3 columns and a row

Sample Input: id,Product1,Product2,Product3,Product4 1,0.1,0.3,0.8,0.7 2,0.6,0.7,0.5,0.9 I need output as : id,productname,product_val 1,Product1,0.1 1,Product2,0.3 1,Product3,0.8 1,Product4,0.7 2,...
0
votes
1answer
149 views

Compare text files with grep

Lets say I have two files, I want to find goodbye which I can do with grep but what i'm struggling with is once I find goodbye matching the next line with the first column of file 1. File1 sss aa ...
0
votes
2answers
34 views

How to use variables in substitution with vim regular expressions

I have a big file that contains among others serveral lines of the following form: USet07-1 USet07-2 USet08-1 USet08-2 . . . USet22-2 . . . I want to remove the hyphen/dash - from these strings in ...
2
votes
3answers
924 views

how to delete line from the XML file

how to delete only the line from xml file ( with sed/awk or perl one liner line ) that start with: <units> and ended with </Networks> as the follwoing <units><unit ip= ....
1
vote
2answers
104 views

How to only leave in given characters in a file?

Purpose: tr -cd '\12\40-\176' but with accents, ex.: á, í, ű, ő, ö, ü, ű, ú, ó, é. In octal: "á" is 341 "\n" is 12 So I tried: [user@notebook ~]$ printf 'XXXá\nXXX' | tr -cd '\12\341' | ...
2
votes
2answers
2k views

Find out on which line in text file is matching word

Is there any way to find out on which line of the text document is some word which is matching pattern for example with grep or something. Thanks.
1
vote
1answer
391 views

Read only specific lines from text file and save matches into variables

I've got this problem. I need to extract some words from text file, which I find by specific pattern in that text. For example: /this/is/path: file1.txt,date-3 file2.txt,date-2 /this/is/path2: file....
2
votes
3answers
116 views

How to cut away the end of a textfile after a specified line

I have == Changelog == in a textfile and I want to create a new file where this line and everything after it will be deleted. I am sure the answer is here somewhere, I have tried to search, now my ...
1
vote
2answers
2k views

How to read only the second last line of a file

I have a client that updates/writes into myfile.csv arbitrarily. I've written the following code, I left the MySQL snippet out: while true do awk_variables_value_array=`tail -n2 myfile.csv | awk -...
1
vote
1answer
572 views

Bash: Looping through a string

I have a variable Vmac that stores values of multiple MAC addresses, collected from wmic call as follows: Vmac=`wmic --delimiter="," --authentication-file=/path/to/file //IP-ADDR "Select AdapterType,...
1
vote
2answers
111 views

Some characters disappear after processing a text file

I've a file named addresses.txt : address1@domain.com address2@domain.com address3@domain.com I'd like to echo "address1@domain.com.html" using for loop. Here's what I did : cat addresses.txt | ...
-1
votes
1answer
207 views

Remove line breaks in a FASTA file

I have a fasta file where the sequences are broken up with newlines. I'd like to remove the newlines. Here's an example of my file: >accession1 ATGGCCCATG GGATCCTAGC >accession2 GATATCCATG ...
0
votes
0answers
29 views

match two files [duplicate]

I have 2 files. The first, fileA looks like TCONS_00000066 XLOC_000030 - u q1:XLOC_000030|TCONS_00000066|0|0.000000|0.000000|0.000000|0.000000|- TCONS_00000130 XLOC_000057 - u q1:XLOC_000057|...
2
votes
2answers
138 views

match first column of file a with paragraphs of file b

I have 2 files. The first, fileA looks like TCONS_00000066 XLOC_000030 - u q1:XLOC_000030|TCONS_00000066|0|0.000000|0.000000|0.000000|0.000000|- TCONS_00000130 XLOC_000057 - ...
5
votes
3answers
6k views

Remove duplicate entries from a CSV file

I've got a [csv] file with duplicate datum reprinted ie the same data printed twice. I've tried using sort's uniq by sort myfile.csv | uniq -u however there is no change in the myfile.csv, also I've ...
1
vote
1answer
66 views

Replace a string in a text file using a shell script not working properly

I have a text file containing this: 0 0 -1 0 1 0 0 0 0 -1 0 0 1.5 0.0 1.0 1 and I want to replace the 1.0 to 2.0 so that it becomes: 0 0 -1 0 1 0 0 0 0 -1 0 0 1.5 0.0 2.0 1 so I use this command:...
2
votes
5answers
228 views

How to reverse the lines between a pattern into another file

I have the following in the input file #Start para 0 hello dq 1 world dq 2 welcomes dq 3 you dq #Start para 0 how tq 1 are tq 2 you tq #Start para 0 say dq 1 hello dq 2 to dq 3 the dq 4 world dq I ...
1
vote
1answer
211 views

Shell : while read line nested

I've two documents: doc1.lst and doc 2.lst I want to take the content of each line and put it as parameters for my SQL query. I tried something like this, please correct me file=doc1.lst ...
3
votes
3answers
628 views

Splitting a sequence into fixed width

I have a file like this which is a two-column tab-separated file. CTGCAGTTTCCCCAAATGTGGGAAACTTGACTGTATAATTTGTGGCAGTGGTA a1 GATTTCCCCAAATGTGGGAAACTCACTCGGCAGGCGTTGATA a2 I want to get an output ...
1
vote
3answers
174 views

How to do find and replace in one field based on the value in the other field?

I have a file like this. IMS00|20140101|Unix|Jan14 IMS01|20140201|Unix|Feb14 IMS02|20140301|Unix|Mar14 IMS03|20140101|Unix|Jan14 IMS04|20140201|Unix|Feb14 My criteria are, if the column 1 value is ...
3
votes
3answers
247 views

Using sed to remove string or paragraph between delimiter

I would like to know who to remove a string or paragraph that are between ((( string ))) Lorem ipsum (((dolor sit amet))), consectetur adipiscing elit. Vestibulum aliquet fringilla est, dictum ...
4
votes
2answers
118 views

Regular expression to match sequences of alphanumerics

Any way using grep/awk/perl to match lines in the form *.* = *.* (i.e. ac4df.bx5dfd8g = ce5def.dd5f7gdgf ) Where * means 0+ alphanumeric char?
1
vote
6answers
2k views

Replace \n with blank in a file

I want to replace \n with blank Input file1 A\n D\n Output file2 I want A D I tried below commands but not able to replace please do needful. cat OUT | tr '\n' ' '
1
vote
2answers
26 views

Transform values in a line by first field

I was wondering if there is an easy way to do the following without writing a script. Transform 1234,"a;b;d" 2345,"e;f;g;h" to 1234,a 1234,b 1234,d 2345,e 2345,f 2345,g 2345,h
1
vote
3answers
341 views

Append based on line count in awk after pattern match

How can I append lines after a pattern match in awk based on how many lines they are after the pattern match. What I have looks like this: Stuff PATTERN a b c a b c a b c ENDOFSECTION Morestuff I ...
2
votes
1answer
37 views

Match and delete lines with ~100 strings

I have a list of roughly 100 entries to be deleted from a csv-delimited file. They are already in another text file called 'tbd.txt; My first thought is to write a bash for loop around 'sed -i' but ...
1
vote
1answer
140 views

Searching file for string surrounded by two other known string?

Question title may be kinda vague, but heres what im attempting to do. I have a html file locally on my server which is changing fairly regularly. It has multiple occurrences of: <p>Jumble of ...
3
votes
1answer
2k views

Bash scripting to scan files for words and create report

Ok yes this is a homework assignment BUT I am NOT looking to have the answers given to me. The scenario is that I need a script that searches all my users home directories for bad words. I need the ...
0
votes
3answers
397 views

How can I capture the common characters between two strings

I'm looking to compare two strings and capture the common part e.g. FILE0000010985.LOG FILE0000010999.LOG FILE0000011000.LOG If I compare 1 to 2, I want the output to be ...
1
vote
3answers
52 views

I want to condense a list of ranges (from-to)

I have data involving codes assigned to ranges in the form of From To Code 0 5 A 5 10 A 10 15 A 15 20 B 20 25 B 25 30 A 30 35 A 35 ...
2
votes
4answers
97 views

grep and print how many times my pattern in file 1 is present in file2

I have a file1 (list of my pattern) like this: file1 Fatty_acid_degradation Aminobenzoate_degradation Amino_sugar_and_nucleotide_sugar_metabolism Amoebiasis and I have a file2 (list of all the ...
2
votes
2answers
2k views

How do I move a line in a text file up or down by one line?

I have some text files, and I'd like to be able to move an arbitrary line in any of the files up or down one line (lines at the beginning or end of the file would stay where they are). I have some ...
1
vote
1answer
62 views

Specify the type of field to modify in a file

I have a list of clients, "code", "name", "location", "etc" and I want to make a function that asks the employee to give the client's code and then the field he/she wants to change. For example, "...
1
vote
1answer
117 views

Shell script runs diffrently based on working directory.

I have a script which runs differently based on current working directory. Basically it processes an .ini file and takes parameters from it and runs mysql backup. Script is running as root user. ...
2
votes
3answers
185 views

Find the number FN with awk

I have one document, and this document has several columns, like this: ,Flag2,,Flag4,Flag5,,,,,Flag10,Flag11,Flag12,Flag13 If I use awk to know the total number of fields, knowing the separator ...
0
votes
1answer
93 views

delete non important characters from command output

the version command in my Linux machines display the following output version Red.Hat.OS. release..........5.5 APP.Release.............4.2.0.0-02 how to remove the middle "." dot character ...
3
votes
2answers
2k views

How do I insert new columns into a .csv file?

Example Data: "Monday","12345","Friday" In the above file, I want to add a new column in between 12345 and Friday. How can I do that ?
1
vote
3answers
141 views

Select and remove lines matching a pattern from a file

grep -Eri "drucken" app/views app/views/meths/_form.html.erb: <li class="hidden-phone"><a onclick="javascript: print();" class="">Methode drucken</a>&...
2
votes
4answers
504 views

How to extract only a part of one line?

I want to extract the essid in a dump file from airodump-ng using grep. The part where I want to extract looks like this: <SSID first-time="Wed Feb 25 07:06:57 2015" last-time="Wed Feb 25 07:...
1
vote
1answer
161 views

Sed regex printing into a file.txt

I'm connected to a MQTT stream, and I filter out the data by entering : mosquitto_sub -d -t +/# 2>&1 | sed -n "/PUBLISH/{s|.*\('.*',\).*|\1$(date),|;N;s/\n//;p}" into the Ubuntu terminal. ...
5
votes
2answers
119 views

Use lines in a file to produce string and file name

I have a file, foo.txt, that has a folder name on each line: folder_1 folder_2 folder_3 And I'd like to do something like this: cat foo.txt | xargs -I {} echo 'function {}() { return stuff; }' >...
5
votes
2answers
325 views

Transpose a file, and replace missing values

I have Readings for Names, from Machines and sometimes these readings are replicated. Where a reading was not found, it is left as blank. Name Instrument Rep R1 R2 R3 N1 I1 1 1 2 3 N2 I1 1 1 3 4 ...
0
votes
1answer
76 views

looping through a file on 2 lines in shell

I have a file which looks like this: >a TCCACTCCACGC >b ACCTCCAG I want to loop through the file in such a way that it takes into account 2 lines at a time i.e >a and its sequence and then ...
4
votes
2answers
135 views

How can set a row as column in unix [duplicate]

How can I set a row as column in Unix. Example: name : Keshav sub : C++ branch: cse DOB :22/09/1990 company:NONE name : Vijay sub : Java branch: cse DOB :22/09/1985 company:NONE I want output ...
0
votes
1answer
58 views

problem with sed inside sed

I am trying to parse a string inside a sed command but I am getting errors. sed -e "/pd begin $(echo 3:1I:1:1|sed 0,/:/{s/:/' '/})",/pd end $(echo 3:1I:1:1|sed 0,/:/{s/:/' '/})/p /tmp/hp-raid-data-...
11
votes
4answers
2k views

How to remove duplicate characters?

If I am having a line as: Thhiisss iisss mmyyy nameeee I want to print this as: This is my name What is the unix command for this?
1
vote
1answer
764 views

Print lines between two patterns matching a condition in awk

How can I print lines between two patterns which meet a certain condition? For instance for an input file partially containing the following: Time %MEM %CPU %SWAP 00:05:02 7.3 ...