The tag has no wiki summary.

learn more… | top users | synonyms

0
votes
1answer
62 views

How can I find and replace only in a range of columns?

I have a text file with 9267 lines. I want to find "A" with 5 spaces after it and replace it with "A" with 5 spaces before and after it on all lines, but only between columns 67 and 88. Text outside ...
2
votes
1answer
52 views

Continously writing terminal output to text file

I am running a small cli python app in terminal. It loops infinitely and outputs text to the terminal. I want to output the text to a file, and I can do that with the following command python [my cli ...
2
votes
5answers
286 views

Duplicate lines and make them unique?

I have the following structure of text lines: 3923 001 L05 LV,L05 RM 3923 002 L12 RA,L12 LA 3923 003 I06 ALL 3923 004 G04 RV,Z09 ALL but i would need this: 3923 001 L05 LV 3923 001 ...
0
votes
1answer
32 views

ArchLinux i3 font rendering issue on Chromium

The font on Chromium's menu items is off-centered as seen below: Only chromium has this issue (I've tested LibreOffice). The font used to be fine, but I believe I made a change somewhere that ...
4
votes
1answer
39 views

Gedit displays text, but cat tells a different story

I am trying to sort a dictionary from Grady Ward's Moby and have encountered a bit of a problem. When I open it in gedit, I get: abaca×N abaciscus×N abacist×N aback×v abacli×p Abaco×N abactinal×A ...
0
votes
0answers
17 views

Searching text data in Hebrew, Arabic or Aramaic

How can I search for a (sub-)string in a database that has several languages, including Hebrew? I am assuming that the text being right-to-left is a question of the presentation, but the logical ...
2
votes
2answers
79 views

add filename as text in the corner of an image file

I have a bunch of jpeg images. Say 001abcd.jpg, 002abcd.jpg, and so on. I want to capture the filename and add it as a text in the image itself in one corner. So the result would be, for example, the ...
0
votes
2answers
93 views

Print text between two patterns not containing a particular word

I wanted to print some text between two patterns which doesn't contain a particular word input text is HEADER asdf asd asd COW assd TAIL sdfsdfs HEADER asdf asd sdfsd DOG sdfsdfsdf TAIL sdfsdfs ...
0
votes
2answers
60 views

compare two files and fetch data

I have two files: File A sample >> AT5G46880.1|PACid:19669936 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- ...
4
votes
1answer
56 views

Print out unicode values of stdin?

I use od to print me the octal or hex of a file/stdin/string. This lets me see the ASCII, or UTF-8 encoded, values of my stdin. But we don't live in ASCIIland anymore. Is there any command that will ...
4
votes
1answer
50 views

How to convert ęąśćżńł TXT to PDF with enscript?

I have problem converting a file to PDF. I create the file with echo ęąśćżńł > text and convert: enscript -O text -o - | ps2pdf - out.pdf However, out.pdf has an encoding problem:
-1
votes
1answer
56 views

How to remove duplicate lines from file? [duplicate]

I have file for example 'a' aaa aaa bbb ccc ccc bbb ddd After executing uniq a c i get file 'c' aaa bbb ccc bbb ddd How to delete duplicate bbb lines?
-3
votes
2answers
69 views

match two files and filter out [duplicate]

I have two files file A >TCONS_00000075 gene=XLOC_000030 CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAGCGCTACGGTC ...
0
votes
5answers
215 views

grep to fetch whole line

I have a file like: Chr1 Cufflinks exon 7136 7944 . + . gene_id "XLOC_000001"; transcript_id "TCONS_00000003"; exon_number "5"; gene_name "LOC_Os01g01010"; oId ...
0
votes
1answer
29 views

text processing

I have two files. file A : Chr1 Cufflinks exon 2903 3268 . + . gene_id "XLOC_000001"; transcript_id "TCONS_00000002"; exon_number "1"; oId "CUFF.1.2"; tss_id "TSS1"; ...
1
vote
1answer
72 views

textutil convert PDF to txt producing garbled output

I am trying to convert PDF files to text files using textutil. I don't if there are special types of PDFs that can and cannot be converted. The files I am trying to convert are in a searchable ...
4
votes
4answers
185 views

Insert new lines with missing values (NA)

I would like to insert new lines in text files if there are missing values. I have for example the following text file (A.txt), for which line 5 is missing. In addition, as the file should have 12 ...
1
vote
2answers
168 views

Search only in plain text files that are not source code

I use following command to search for string ELF in plain text files under the current directory recursively: grep ELF -r . but it also searches in binary files (e.g. zip file, PDF file), and in ...
1
vote
0answers
73 views

Text User Interface

I have been working on a shell script, and was wondering if I can put up a text user interface for the shell script. After some searching, I see few people suggest using "ncurses/curses". However the ...
3
votes
3answers
218 views

display filename followed by content without interaction

My program writes it state to few files every 30 seconds or so (overwrites) and I would like to look at them with the filenames displayed like "more" does. Like: $ echo 1234 > test00 $ echo 5678 ...
1
vote
2answers
112 views

Extract words instead of letters from pdf files?

I use less which uses pdftotext to extract text from pdf files, by less my.pdf. In this way, some words' letters are separated by spaces from a pdf file. CH APTE R 2 5 T E ST IN G WE B A P P ...
1
vote
1answer
148 views

Special characters in a web feed

I am running a script to check my gmail from the command line and display the first 35 characters in the title. curl -u username:password --silent "https://mail.google.com/mail/feed/atom" | \ grep ...
1
vote
1answer
175 views

change linux text console scrolling speed - without rebooting

Is there any way to change to the text console scrolling speed without rebooting? Currently using Fedora, but non-distribution-specific answers appreciated. ...
0
votes
2answers
60 views

How do I download a PDF, then output a chunk of text?

My city water bill is emailed to me every month as a link to the current PDF hosted on their server. So I can easily download this PDF any time I want. How do I take that PDF and extract my account ...
0
votes
1answer
106 views

Running Linux in text mode - blank diamonds instead of Chinese/Punjabi etc. characters

While in the text mode and using, for example, Chinese/Simplified or India/Punjabi locale I get blank diamond symbols in the console in place of the characters. I am running Xubuntu with ...
3
votes
1answer
248 views

How do I view cp1251 text file in UTF-8 console?

Attempt 1: $ less subs.srt "subs.srt" may be a binary file. See it anyway? <C8><F2><E0><EB><FC><FF><ED> ... Attempt 2: $ LANG=ru_RU.CP1251 less subs.srt ...
0
votes
1answer
58 views

Is there something similar to the Notepad++ session workflow?

Is tmux+vim/nano the closest thing to the Notepad++ workflow (in recent versions of Notepad++ that automatically save session state)? I really miss that, it was convenient to just dump text I copied ...
0
votes
1answer
574 views

How to add new line in text file in output from remote shell script using plink

From windows i am executing a remote shell script using putty plink cmd>plink.exe -ssh username@hostipd -pw gbG8qs4 /user/alice/listoffiles.sh > C:\log1.txt Shell script in remote server #! ...
1
vote
1answer
436 views

Converting a UTF-8 file to ASCII (best-effort)

I have a file in UTF-8 that contains texts in multiple languages. A lot of it are people's names. I need to convert it to ASCII and I need the result to look as decent as possible. There are many ...
1
vote
1answer
79 views

How to add searchable text to an image?

I need to add text to an image (original image can be jpg, gif, or bmp) file, how can I do it? I added the texts with shutter to an jpg and converted to pdf. Tesseract has not been able to turn the ...
3
votes
1answer
914 views

Determine the new line character in a text file?

given a text, is there a program that can detect what the new line character is, the Windows, Mac, or Linux one? Eg, the following text is shown by less memor:^M^Mis storage directly accessible ...
1
vote
1answer
81 views

Using sed to align text starting from pattern to end of line

I have a text like this: LDX LEVEL LDA INITD015,X ; INITIAL ACTIVE SPRITES STA $D015 STA SAVED015 LDA INITXPOS,X ; INITIAL HERO X COORDINATE STA XPOS LDA ...
1
vote
2answers
206 views

Extracting file name and string from multiple files

I have a lot of files (>100,000) from which I would like to extract a specific string and the filename itself. Files are organized like this: Filename: sequence.php?ID=gi|90022703|ref|YP_528530.1| ...
4
votes
2answers
54 views

More shell scripts than one in one text file?

I am learning shell scripting for my introductory UNIX course at my university, and I`m curious if is it possible to have more than one shell script in one text file. What I mean by that is, for ...
3
votes
1answer
156 views

Preventing mid-word line breaks in a2ps

So I understand that a2ps is mostly for converting ASCII code to postscript for printing, but occasionally I like to print a .txt or .md file for school. Often, an entire sentence (or even a ...
0
votes
2answers
169 views

How to copy text from an image in a pdf file?

I can view a pdf image with text using the evince document viewer, however I cannot select the text in the image to copy and paste. How do I copy text from an image in a pdf file?
1
vote
3answers
136 views

cat a directories files apending the file name to the row of text and removing the header row? [closed]

How can I cat a directories files apending the file name to the row of text and removing the header row? So as to only have 1 header row in the all.txt file.
1
vote
1answer
28 views

why does emacs stop superuser from editing files without permissions?

If I have a file I want to edit, as root, I should have the ability to modify it regarless of the permissions. But this does not seem to be the case with all text editors, emacs in particular. If ...
3
votes
1answer
184 views

Copying clipboard-content to file automatically and continiously?

I need to make a list of some links on a web-page. I've been using right-click copy link URL and then pasting it (Menu_Edit->Paste) into vim running in xterm -- then repeating. This is obviously a ...
2
votes
2answers
304 views

Format output to a specific line length

So I have some output that has very long lines, and I want to have it formatted to lines no more than 80 columns wide, but I don't want to split words because they are in the column limit. I tried ...
1
vote
1answer
77 views

Command line utility for reading tabular data

I am looking for a command line utility that would allow me to quickly investigate structure of a large dataset. Right now I am doing it by using: head -n 2 dataset but the problem is that the width ...
6
votes
1answer
1k views

Converting .docx files to plain text and preserving line breaks to maintain line number references to source document: howto & implications?

I'm exporting MS Word content to plain text for use with text&file utilities. I have a constraint where the line numbering feature has been enabled in the MS software, and any reference to line ...
5
votes
1answer
315 views

Cannot cat or grep contents of file

I'm on Debian Jessie. When I open a new textfile with mousepad and save it, then modify it with vim and save it again, I cannot print or grep the contents of it anymore. If I do cat file, nothing is ...
1
vote
2answers
187 views

Possible to view two text files side by side (read only)?

In emacs, we can view two text files side by side. Is it also possible to do so in some simpler/lighter applications such as less? Only viewing, no editing.
4
votes
2answers
87 views

Verify line endings from a text created by perl script

I am interested in seeing the contents of a text file in hex mode. I have tried :%!xxd and the problem is that I can not really understand which hex code represents each letter e.g. when you use an ...
1
vote
1answer
112 views

How to echo from specific line of a file to another specific line [duplicate]

Assume I have a file with about 10000 lines. How can I print 100 lines, starting from line 1200 to line 1300?
1
vote
2answers
174 views

Using source downloaded on windows on Linux platform

I downloaded the Linux source code from the git repository on Windows and then copied the files to Fedora. I am unable to the build the kernel. Is this, because I downloaded the source on Windows ...
0
votes
4answers
603 views

grep to see if a line ends with a particular string

Hello I have a file that has a lot of lines that end with main.css">, and some of them are repeated. I want to keep only one copy of these lines and delete the repeated line. Could I use grep to ...
10
votes
2answers
784 views

Filter output of command by color

I am running a utility that doesn't offer a way to filter its output. Nothing in the text of the output indicates that a particular function failed but it does show in red. The output is so long that ...
11
votes
2answers
5k views

What is the ^M character called?

TexPad is creating it. I know that it is under some deadkey. I just cannot remember it is name. The blue character: I just want to mass remove them from my document. How can you type it?