The tag has no usage guidance.

learn more… | top users | synonyms

0
votes
0answers
20 views

Text as block on Kali Linux Rolling after apt-get upgrade

I just installed Kali Linux Rolling and I run apt-get upgrade. When it finished on the tweak tool on the appearance tab in the cursor option, I get this text "Adwaita [][][][][][][][][]" instant of ...
1
vote
0answers
28 views

Read and write line from .txt, in CSH script [closed]

well I have to do a basic script,is mandatory in csh, and I decided to do a simple "task manager". Based on a .txt file, the user can add task, show tasks, delete X task. The problem I don't manage to ...
0
votes
0answers
20 views

Tips for parsing proprietary file formats?

So I got a quarkxpress file. The problem is, it confidential, so I can't upload here. In general, given some proprietary file format, what steps can you take to recover data from it in linux? I have ...
2
votes
0answers
31 views

Command like `column -t` but encoding-type agnostic? [closed]

Essentially, I am looking for an encoding-type agnostic version of the column -t command in linux. I need to convert delimited files to flat and then write to an outfile. The specific delimiter ...
6
votes
1answer
37 views

How can I make `file` output line break type and encoding for all file types?

I often find myself in the need to check the encoding and the line break type of a file. The file utility seems to be a perfect fit. Unfortunately it doesn't output the desired information for all ...
0
votes
0answers
22 views

How to extract text out of QuarkXPress file in linux?

Is there a way to extract the text from QuarkXPress? (Preferably, I would not want to use QuarkXPress itself, but free software compatible with it.)
0
votes
2answers
42 views

Check whether a file uses CRLF or LF to end lines [duplicate]

How to check whether lines in a text file end with CRLF or LF?
1
vote
3answers
48 views

How to extract “foo” from “foo-bar-baz” in bash? [duplicate]

I'm trying to extract foo from the string "foo-bar-baz" in bash. Any ideas how to do it using string substitution or something similar (without external tools). I tried this but it didn't work: $ ...
3
votes
4answers
100 views

How do I create a text file (1 gigabyte) containg random characters with UTF-8 character encoding?

The following command does not use UTF-8: head -c 1M </dev/urandom >myfile.txt
3
votes
1answer
91 views

Extract specific columns from text file

There is a text file, with aboot 10000+ lines, in the format: field1 field2 field3 field4 field5 ... fieldX It needs to be converted to look like: field1,field2,field4,field3,field5 to fieldX The ...
1
vote
1answer
26 views

save output of a python script to a text file

how can i save output of this python script to a text file? this is a KMS server which clients connect to it and activates their windows or office. i wanted to save the log in a text file. I should ...
3
votes
1answer
43 views

Exclude similar values from awk

Kindly consider below files: File 1: boo,194,2322 foo,999,7559 File 2: boo,2322 boo,4526 foo,4222 foo,4223 I need to link Field1 in File 1 with Field1 in File 2 and get the related Field2 ...
0
votes
3answers
44 views

Search for number in text [closed]

I have a text file and I want so scan this text file for a specific number. Lets say the text file is: asdg32dasdgdsa dsagdssa11 adad 12345 dsaga Now I want to search for a number with the length ...
1
vote
0answers
61 views

How can I recieve SMS texts with the mail command? [closed]

I have figured out how to send sms messages with mail; the same way I would with regular email, by sending my message to phonenumber@SMSgate. This works great. I've also entered "linux" in ...
0
votes
0answers
29 views

CentOS 7 VM small text issue at High Resolution

I recently created a CentOS 7 VM in order to prepare for the RHCSA 7 exam (since they are both based on Fedora and are quite similar, I decided to opt for CentOS 7 as it is free, and RHEL isn't). In ...
0
votes
1answer
34 views

Default text file permissions?

How do I find out the default permissions for a newly created text file? I've tried ls -l filename.txt but it keeps saying it cannot access the txt file, so im pretty sure I'm doing it wrong ...
1
vote
2answers
60 views

What's the best way display tabs/spaces in my plain text files

I have a file that unfortunately contains both tabs and spaces. How do I display them so I know if a particular space is actually tab or space?
0
votes
0answers
22 views

In sed, what's the best way to apply blocks of commands to multiple addresses?

If I have a block of sed commands I want to apply to multiple addresses that aren't an address range, what is the best way to do this without repeating the block separately for each address? The only ...
0
votes
1answer
39 views

Can you replace displayed text with something else in command window?

I am trying to manage user accounts. They are basically just numbers, but I would rather see user last names on the screen. Is it possible to automatically replace displayed text with something else? ...
3
votes
0answers
10 views

With EN/HE layout, why do the arrow keys switch from logical to visual with Ctrl down?

I type in both Hebrew and English. When I use the Windows Manager's dialogs, or a GUI text editor such as leafpad, and type Hebrew text, I find the horizontal arrow keys (LeftArrow and RightArrow) ...
2
votes
3answers
95 views

uniq showing duplicate lines

$ grep home american.txt | sort | uniq A home and a country should leave us no more! ...
0
votes
0answers
34 views

What's wrong with this conky config? It's dog slow and doesn't display most of the text

It looks fine other than that it runs very slowly and I don't get any text beyond the 9th line or so. Window is the right size. I've got this feeling like Conky is the wrong tool for this. For the ...
1
vote
0answers
23 views

Print pdf like paps, but with actual fonts?

So I convert a piece of text to PDF like so: INPUT="this text goes to a pdf file" paps $INPUT 2>/dev/null | ps2pdf -sPAPERSIZE=a4 -dOptimize=true -dEmbedAllFonts=true - out.pdf Which works ...
0
votes
0answers
14 views

sorting files using header information [duplicate]

I have multiple image files inside a directory having the same extension (.mrc). In the terminal, if I do, header , it gives following output: RO image file on unit 1 : ...
0
votes
0answers
29 views

Polish–Vietnamese mojibake in a .txt file, using LibreOffice, mousepad, and vim

I have a trouble with some .txt file. When I try open it with mousepad, vim or LibreOffice Writer in every case some Polish letters are changing to another, incorrectly (i.e. correct char ś and ć are ...
0
votes
3answers
69 views

Make curl/cat not scroll down when given long text?

I have made a program where I read the text from a url using curl. The problem is that when given texts that are larger than the terminal window, it automatically scrolls down to the bottom, I want to ...
0
votes
1answer
187 views

How can I find and replace only in a range of columns?

I have a text file with 9267 lines. I want to find "A" with 5 spaces after it and replace it with "A" with 5 spaces before and after it on all lines, but only between columns 67 and 88. Text outside ...
2
votes
1answer
183 views

Continously writing terminal output to text file

I am running a small cli python app in terminal. It loops infinitely and outputs text to the terminal. I want to output the text to a file, and I can do that with the following command python [my cli ...
2
votes
5answers
313 views

Duplicate lines and make them unique?

I have the following structure of text lines: 3923 001 L05 LV,L05 RM 3923 002 L12 RA,L12 LA 3923 003 I06 ALL 3923 004 G04 RV,Z09 ALL but i would need this: 3923 001 L05 LV 3923 001 ...
0
votes
1answer
145 views

ArchLinux i3 font rendering issue on Chromium

The font on Chromium's menu items is off-centered as seen below: Only chromium has this issue (I've tested LibreOffice). The font used to be fine, but I believe I made a change somewhere that ...
4
votes
1answer
88 views

Gedit displays text, but cat tells a different story

I am trying to sort a dictionary from Grady Ward's Moby and have encountered a bit of a problem. When I open it in gedit, I get: abaca×N abaciscus×N abacist×N aback×v abacli×p Abaco×N abactinal×A ...
0
votes
0answers
35 views

Searching text data in Hebrew, Arabic or Aramaic

How can I search for a (sub-)string in a database that has several languages, including Hebrew? I am assuming that the text being right-to-left is a question of the presentation, but the logical ...
2
votes
2answers
411 views

add filename as text in the corner of an image file

I have a bunch of jpeg images. Say 001abcd.jpg, 002abcd.jpg, and so on. I want to capture the filename and add it as a text in the image itself in one corner. So the result would be, for example, the ...
0
votes
2answers
240 views

Print text between two patterns not containing a particular word

I wanted to print some text between two patterns which doesn't contain a particular word input text is HEADER asdf asd asd COW assd TAIL sdfsdfs HEADER asdf asd sdfsd DOG sdfsdfsdf TAIL sdfsdfs ...
0
votes
2answers
70 views

compare two files and fetch data

I have two files: File A sample >> AT5G46880.1|PACid:19669936 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- ...
4
votes
1answer
104 views

Print out unicode values of stdin?

I use od to print me the octal or hex of a file/stdin/string. This lets me see the ASCII, or UTF-8 encoded, values of my stdin. But we don't live in ASCIIland anymore. Is there any command that will ...
4
votes
1answer
85 views

How to convert ęąśćżńł TXT to PDF with enscript?

I have problem converting a file to PDF. I create the file with echo ęąśćżńł > text and convert: enscript -O text -o - | ps2pdf - out.pdf However, out.pdf has an encoding problem:
0
votes
1answer
84 views

How to remove duplicate lines from file? [duplicate]

I have file for example 'a' aaa aaa bbb ccc ccc bbb ddd After executing uniq a c i get file 'c' aaa bbb ccc bbb ddd How to delete duplicate bbb lines?
-3
votes
2answers
97 views

match two files and filter out [duplicate]

I have two files file A >TCONS_00000075 gene=XLOC_000030 CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAGCGCTACGGTC ...
0
votes
5answers
242 views

grep to fetch whole line

I have a file like: Chr1 Cufflinks exon 7136 7944 . + . gene_id "XLOC_000001"; transcript_id "TCONS_00000003"; exon_number "5"; gene_name "LOC_Os01g01010"; oId ...
0
votes
1answer
29 views

text processing

I have two files. file A : Chr1 Cufflinks exon 2903 3268 . + . gene_id "XLOC_000001"; transcript_id "TCONS_00000002"; exon_number "1"; oId "CUFF.1.2"; tss_id "TSS1"; ...
1
vote
1answer
197 views

textutil convert PDF to txt producing garbled output

I am trying to convert PDF files to text files using textutil. I don't if there are special types of PDFs that can and cannot be converted. The files I am trying to convert are in a searchable ...
4
votes
4answers
294 views

Insert new lines with missing values (NA)

I would like to insert new lines in text files if there are missing values. I have for example the following text file (A.txt), for which line 5 is missing. In addition, as the file should have 12 ...
1
vote
2answers
322 views

Search only in plain text files that are not source code

I use following command to search for string ELF in plain text files under the current directory recursively: grep ELF -r . but it also searches in binary files (e.g. zip file, PDF file), and in ...
1
vote
0answers
136 views

Text User Interface

I have been working on a shell script, and was wondering if I can put up a text user interface for the shell script. After some searching, I see few people suggest using "ncurses/curses". However the ...
3
votes
3answers
247 views

display filename followed by content without interaction

My program writes it state to few files every 30 seconds or so (overwrites) and I would like to look at them with the filenames displayed like "more" does. Like: $ echo 1234 > test00 $ echo 5678 ...
1
vote
2answers
163 views

Extract words instead of letters from pdf files?

I use less which uses pdftotext to extract text from pdf files, by less my.pdf. In this way, some words' letters are separated by spaces from a pdf file. CH APTE R 2 5 T E ST IN G WE B A P P ...
1
vote
1answer
268 views

Special characters in a web feed

I am running a script to check my gmail from the command line and display the first 35 characters in the title. curl -u username:password --silent "https://mail.google.com/mail/feed/atom" | \ grep ...
1
vote
1answer
353 views

change linux text console scrolling speed - without rebooting

Is there any way to change to the text console scrolling speed without rebooting? Currently using Fedora, but non-distribution-specific answers appreciated. ...
0
votes
2answers
81 views

How do I download a PDF, then output a chunk of text?

My city water bill is emailed to me every month as a link to the current PDF hosted on their server. So I can easily download this PDF any time I want. How do I take that PDF and extract my account ...