The shell is unix's command-line interface. You can type commands in a shell interactively, or write scripts to automate tasks. Use this tag for questions applying to /bin/sh and most compatible shells (ash, bash, ksh, zsh, …).

learn more… | top users | synonyms (1)

1
vote
1answer
14 views

remove lines where a field's value is less than or equal to 3 - sed or awk?

I need to remove every line that has a value of 2 or less in the 8th field (column). My data looks like this: 12-31 Airport 189 379 41 49.70946503 -124.91377258 2 2880 30.8 01-01 ...
0
votes
0answers
17 views

convert from one memory format to another and find the difference between them

Using shell scripting, how can I convert from one memory format to another and find the difference between them? I want to compare current rate and previous memory rate (Where we need to compare ...
-2
votes
0answers
20 views

print character in specific rows and columns [on hold]

I have one file F1 having data Column 1 will represent character and column 2 represent multipliers (number of time a character suppose to be repeat). file 1 as input: A 2 B 4 C 4 D 6 ...
1
vote
1answer
28 views

Specify the type of field to modify in a file

I have a list of clients, "code", "name", "location", "etc" and I want to make a function that asks the employee to give the client's code and then the field he/she wants to change. For example, ...
1
vote
1answer
38 views

loop through multiple folders and perform commands then write to file

I have 10 folders that I want to loop through while executing the following command: awk 'FNR > 1' *.csv | sort -sk 1,2 | sort -sk 3,3 > ${f}_appended.dat With a for loop wrapper, like ...
10
votes
1answer
246 views

Renaming the current directory from a shell - possible?

Is it possible to rename the current working directory from within a shell (Bash in my particular case)? If I attempt to do this the straightforward way, I end up with an error: ...
2
votes
3answers
43 views

Calculate date difference between Last modified date of a file and NOW using shell script

I am trying to calculate the time elapsed since the log file was last updated. I guess following commands will be used lastUpdate=$(date -r myLogFile.log) now=$(date) How can I subtract them and ...
2
votes
3answers
40 views

space check on unix machines

I am having space issues on 1 of the UNIX servers. I am executing the below command to check the space utilization. But this command is very slow and takes hours of time to give the result. du -sg * ...
1
vote
1answer
47 views

Shell script runs diffrently based on working directory.

I have a script which runs differently based on current working directory. Basically it processes an .ini file and takes parameters from it and runs mysql backup. Script is running as root user. ...
2
votes
5answers
153 views

Pick the latest file based upon the sequence number given in the file name

I have a requirement, I have few files in a directory, I need to pick the oldest one for processing. For Exp: I have below files in /tmp directory: Sample_0000237826-001_xyz.dat ...
0
votes
0answers
9 views

sending NEDIT to background on launching

I have this problem - for opening nedit it will open in the foreground. Then either you open it using & ex- prompt> nedit & is there any way where I can open nedit directly in the ...
2
votes
2answers
1k views

Using sudoers to allow php to run command

I am trying to get my php page to run this command: shell_exec("sudo /home/xbian/433Utils/RPi_utils/codesend {$num}"); So I added this entry to my sudoers file with visudo: www-data ALL=NOPASSWD: ...
0
votes
1answer
20 views

Error with sed on MAC OS X invalid command u

Im french sorry in advance for my bad english... So i have an error on MAC OS X when im using sed sed -i '' '/user_pref("mail.identity.id1.reply_on_top", 1);/ a\ ...
0
votes
1answer
12 views

Having problem with mysql dbdump when password starts with special character

I am trying to take a db backup with a php file that is running from a cronjob. It was running fine when I tested with sample db. But when I used the actual db there was an error. I am using ...
52
votes
4answers
3k views

Why is `[` a shell builtin and `[[` a shell keyword?

As far as I know, [[ is an enhanced version of [, but I am confused when I see [[ as a keyword and [ being shown as a builtin. [root@server ~]# type [ [ is a shell builtin [root@server ~]# type [[ [[ ...
0
votes
2answers
33 views

What is difference between Power broker utility and sudo command?

I got a little clarity with the following answer on this Source Symark Power Broker is a commercial package. Sudo is an open source tool.
-1
votes
1answer
38 views

Can you please tell me what is wrong in below script?

script : it is giving below error. please help me. basically i need to get email when memory exceeds some limit. error : ./vamsitest.sh: line 10: [: missing `]'   #! /bin/bash # Total memory ...
1
vote
2answers
405 views

Script to su -c into a screen is not working as intended

I'm working on a script that will allow me to load up a screen from a user via sudo and su -c. However, when I use it, it will just show the shell of the user: sudo su -c "script /dev/null; screen -r ...
4
votes
2answers
256 views

How to echo `single quote` when using single quote to wrap special characters in shell?

I'm reading shell tutorial today from http://www.tutorialspoint.com/unix/unix-quoting-mechanisms.htm In which it mentions: If a single quote appears within a string to be output, you should not ...
1
vote
0answers
31 views

delete non important characters from command output

the version command in my Linux machines display the following output version Red.Hat.OS. release..........5.5 APP.Release.............4.2.0.0-02 how to remove the middle "." dot character ...
8
votes
4answers
605 views

Spaces next to pipes

I've seen history | grep blah and history |grep blah; and history|grep blah also works, though no one ever seems to use it. Is there any significance in the spaces (e.g. piping to/from different ...
0
votes
3answers
50 views

How to use password in shell scripting

I am writing a script which greps for for multiple files from 3 log files. One of the log file is created as superuser and every time it executes it prompts for password. How do I put it the same ...
0
votes
1answer
19 views

Unable to extract to specific directory

I am trying to extract to file to specific directory but it doesn't produce result Operating system : SunOS Command: zcat /export/home/tceng/Desktop/temp/3.tar.Z | tar -xf - -C ...
2
votes
1answer
29 views

Windowless xterm? (Faking a terminal for a process)

I'm fighting with a rather odd problem with Matlab. The startup script is located in /opt/matlab_2013b/bin and is called matlab. When I run it in terminal, it works fine. But I want to make a ...
10
votes
3answers
960 views

What's the difference between semicolon and double ampersand && [duplicate]

What is the difference between echo "Hello " ; echo "world" and echo "Hello " && echo "world" Both seems to run the two commands after each other.
3
votes
3answers
60 views

How to bump file timestamps by 3 months (for a directory tree)?

I am looking at the touch command line utility (on Linux), and from the examples I found in tutorials, I see how one can bump the access or modification timestamp to a specified time, the current ...
5
votes
3answers
180 views

Echoing stdin when running an ed(1) script

Given the following ed script, $ cat helloworld a hello world . ,n ,s,o,O,g ,n Q I would like to obtain somehow the interactive output $ ed a hello world . ,n 1 hello 2 world ,s,o,O,g ,n 1 ...
1
vote
1answer
39 views

When did bash quit exporting SHELL?

I upgraded a Debian box from stable to Jessie and I noticed that SHELL is no longer exported, so screen and similar programs start dash for subshells instead of bash. When was this change made and ...
0
votes
2answers
40 views

Gzip file but excluding some directories|files and also append current date

I'm looking for a way to create a .tar.gz file from a directory but I have some doubts. I'm know that the command for create the file is: tar -zcvf /path/to/compressed/file.tar.gz /path/to/compress ...
2
votes
1answer
41 views

attempting to put dynamic input data in a variable via cat method

I'm attempting to write a bash script that should be able to collect data from ttyS0 and put in a variable. I need to talk with a device on the serial line, that is a module able to receive AT ...
1
vote
2answers
65 views

use “read” command to pass lines as positional parameters to a shell script

The following file runs, but not doing anything, yet it does not error.... while read dates; do ./avg_hrly_all_final.sh ${dates}; done < ./dates_all.csv I have a list of dates in ...
6
votes
3answers
836 views

Best way to swap filenames

I need to swap filenames of two files (file and file_1). I'm using the following code for it. mv file .phfile mv file_1 file mv .phfile file This works but is very buggy, It sometimes even results ...
91
votes
3answers
23k views

What does “--” (double-dash) mean? (also known as “bare double dash”)

I have seen -- used in the compgen command. For example: compgen -W "foo bar baz" -- b What is the meaning of the --.
0
votes
1answer
24 views

explain this shell command with redirection and pipe

I can understand the statements like. bzip2 --version >/tmp/list_right 2>/tmp/list_error bzip2 --version >/tmp/list 2>&1 But I don't understand the statement: bzip2 --version ...
0
votes
1answer
1k views

How to execute Netscaler commands through a remote machine via SSH connection

I have been trying to execute some NetScaler commands like "bind" & "unbind" through a Linux Box via an SSH Connection. Now the Problem is, Manually we are able to enter & execute commands on ...
1
vote
0answers
38 views

Bash cannot see PATH update

I am running Debian on a VM. I login to the GUI and go to Applications > Accessories > Terminal. # echo shell: /bin/bash I modified ENV_SUPATH, ENV_PATH inside of /etc/login.defs. I restarted ...
2
votes
3answers
3k views

How to escape a single quote? [duplicate]

This works fine: sed -i 's# @driver.find_element(:xpath, "//a\[contains(@href,##' temp_spec.rb against a source of @driver.find_element(:xpath, "//a[contains(@href,'change_district')]").click ...
1
vote
0answers
59 views

Sed regex printing into a file.txt

I'm connected to a MQTT stream, and I filter out the data by entering : mosquitto_sub -d -t +/# 2>&1 | sed -n "/PUBLISH/{s|.*\('.*',\).*|\1$(date),|;N;s/\n//;p}" into the Ubuntu terminal. ...
0
votes
1answer
31 views

looping through a file on 2 lines in shell

I have a file which looks like this: >a TCCACTCCACGC >b ACCTCCAG I want to loop through the file in such a way that it takes into account 2 lines at a time i.e >a and its sequence and then ...
9
votes
3answers
9k views

How to escape quotes in shell?

I'm having trouble with escaping characters in bash. I'd like to escape single and double quotes while running a command under a different user. For the purposes of this question let's say I want to ...
69
votes
12answers
27k views

Get exit status of process that's piped to another

I have two processes foo and bar, connected with a pipe: $ foo | bar bar always exits 0; I'm interested in the exit code of foo. Is there any way to get at it?
4
votes
3answers
495 views

How to escape single quotes correctly creating an alias [duplicate]

I've been given this one-liner to know how much memory my processes consume. $ ps -u $USER -o pid,rss,command | \ awk '{print $0}{sum+=$2} END {print "Total", sum/1024, "MB"}' Now I'd like to ...
1
vote
1answer
19 views

Multi-platform web based terminal emulator

Is there a web-based terminal emulator compatible with all device like pc browser, smarthphone and tablets (android and iOs)? I tried shellinabox, but with iOS doesn't work correctly (can't activate ...
9
votes
3answers
2k views

Stay at same working directory when changing to sudo

When working on the command line, I often change to sudo using sudo -i. However, my working directory changes automatically to /root. I never want to go there; I want to stay where I was! How can I ...
4
votes
2answers
51 views

How to get the real name of the controlling terminal?

How can one get the real name of the controlling terminal (if there is one, else an error) as a pathname? By "real name", I mean not /dev/tty, which cannot be used by other arbitrary processes to ...
0
votes
2answers
50 views

how to save the contents of a webpage in a file using shell script

how to save the contents of a webpage in a file using shell script. Web page is using URL, username and password to open. curl -O odcview:password ...
4
votes
2answers
61 views

How to delete part of a binary file without copying

I need to delete the first 2 bytes of a 6MB file. However, this is an embedded Linux with only 32 Mbytes RAM and less than 1 MB free flash memory. I tried using dd, as: 1 - # dd bs=1 skip=2 ...
0
votes
0answers
30 views

Unrecoginzed option: using 'getopt' cmd in shell script [on hold]

What is wrong in the command: if ! options=$(getopt -n myscript -l a:,b:,cc:,dd:,ee:,ff:,gg:,hh: -- "$@"); then exit 1; fi I get an error msg: mhagent: unrecognized option '--hh' options=' --aa ...
0
votes
3answers
76 views

Using grep in shell script

I have a text file which looks like this(I am showing few lines of it) INDEX : 1 snRNA_seq:TTTTGGAGCAGGGAGATGGAAT miRNA_seq:CTCCTGACTCCAGGTCCTGTGT target: ...
4
votes
2answers
55 views

How can set a row as column in unix [duplicate]

How can I set a row as column in Unix. Example: name : Keshav sub : C++ branch: cse DOB :22/09/1990 company:NONE name : Vijay sub : Java branch: cse DOB :22/09/1985 company:NONE I want output ...