The shell is unix's command-line interface. You can type commands in a shell interactively, or write scripts to automate tasks. Use this tag for questions applying to /bin/sh and most compatible shells (ash, bash, ksh, zsh, …).

learn more… | top users | synonyms (1)

2
votes
1answer
36 views

attempting to put dynamic input data in a variable via cat method

I'm attempting to write a bash script that should be able to collect data from ttyS0 and put in a variable. I need to talk with a device on the serial line, that is a module able to receive AT ...
5
votes
3answers
168 views

Echoing stdin when running an ed(1) script

Given the following ed script, $ cat helloworld a hello world . ,n ,s,o,O,g ,n Q I would like to obtain somehow the interactive output $ ed a hello world . ,n 1 hello 2 world ,s,o,O,g ,n 1 ...
0
votes
2answers
26 views

Gzip file but excluding some directories|files and also append current date

I'm looking for a way to create a .tar.gz file from a directory but I have some doubts. I'm know that the command for create the file is: tar -zcvf /path/to/compressed/file.tar.gz /path/to/compress ...
1
vote
2answers
44 views

use “read” command to pass lines as positional parameters to a shell script

The following file runs, but not doing anything, yet it does not error.... while read dates; do ./avg_hrly_all_final.sh ${dates}; done < ./dates_all.csv I have a list of dates in ...
6
votes
3answers
829 views

Best way to swap filenames

I need to swap filenames of two files (file and file_1). I'm using the following code for it. mv file .phfile mv file_1 file mv .phfile file This works but is very buggy, It sometimes even results ...
91
votes
3answers
22k views

What does “--” (double-dash) mean? (also known as “bare double dash”)

I have seen -- used in the compgen command. For example: compgen -W "foo bar baz" -- b What is the meaning of the --.
0
votes
1answer
20 views

explain this shell command with redirection and pipe

I can understand the statements like. bzip2 --version >/tmp/list_right 2>/tmp/list_error bzip2 --version >/tmp/list 2>&1 But I don't understand the statement: bzip2 --version ...
0
votes
1answer
1k views

How to execute Netscaler commands through a remote machine via SSH connection

I have been trying to execute some NetScaler commands like "bind" & "unbind" through a Linux Box via an SSH Connection. Now the Problem is, Manually we are able to enter & execute commands on ...
1
vote
0answers
37 views

Bash cannot see PATH update

I am running Debian on a VM. I login to the GUI and go to Applications > Accessories > Terminal. # echo shell: /bin/bash I modified ENV_SUPATH, ENV_PATH inside of /etc/login.defs. I restarted ...
2
votes
3answers
3k views

How to escape a single quote? [duplicate]

This works fine: sed -i 's# @driver.find_element(:xpath, "//a\[contains(@href,##' temp_spec.rb against a source of @driver.find_element(:xpath, "//a[contains(@href,'change_district')]").click ...
1
vote
0answers
54 views

Sed regex printing into a file.txt

I'm connected to a MQTT stream, and I filter out the data by entering : mosquitto_sub -d -t +/# 2>&1 | sed -n "/PUBLISH/{s|.*\('.*',\).*|\1$(date),|;N;s/\n//;p}" into the Ubuntu terminal. ...
0
votes
1answer
27 views

looping through a file on 2 lines in shell

I have a file which looks like this: >a TCCACTCCACGC >b ACCTCCAG I want to loop through the file in such a way that it takes into account 2 lines at a time i.e >a and its sequence and then ...
9
votes
3answers
9k views

How to escape quotes in shell?

I'm having trouble with escaping characters in bash. I'd like to escape single and double quotes while running a command under a different user. For the purposes of this question let's say I want to ...
69
votes
12answers
26k views

Get exit status of process that's piped to another

I have two processes foo and bar, connected with a pipe: $ foo | bar bar always exits 0; I'm interested in the exit code of foo. Is there any way to get at it?
4
votes
3answers
483 views

How to escape single quotes correctly creating an alias [duplicate]

I've been given this one-liner to know how much memory my processes consume. $ ps -u $USER -o pid,rss,command | \ awk '{print $0}{sum+=$2} END {print "Total", sum/1024, "MB"}' Now I'd like to ...
1
vote
1answer
19 views

Multi-platform web based terminal emulator

Is there a web-based terminal emulator compatible with all device like pc browser, smarthphone and tablets (android and iOs)? I tried shellinabox, but with iOS doesn't work correctly (can't activate ...
9
votes
3answers
2k views

Stay at same working directory when changing to sudo

When working on the command line, I often change to sudo using sudo -i. However, my working directory changes automatically to /root. I never want to go there; I want to stay where I was! How can I ...
4
votes
2answers
47 views

How to get the real name of the controlling terminal?

How can one get the real name of the controlling terminal (if there is one, else an error) as a pathname? By "real name", I mean not /dev/tty, which cannot be used by other arbitrary processes to ...
9
votes
3answers
934 views

What's the difference between semicolon and double ampersand && [duplicate]

What is the difference between echo "Hello " ; echo "world" and echo "Hello " && echo "world" Both seems to run the two commands after each other.
0
votes
2answers
45 views

how to save the contents of a webpage in a file using shell script

how to save the contents of a webpage in a file using shell script. Web page is using URL, username and password to open. curl -O odcview:password ...
4
votes
2answers
54 views

How to delete part of a binary file without copying

I need to delete the first 2 bytes of a 6MB file. However, this is an embedded Linux with only 32 Mbytes RAM and less than 1 MB free flash memory. I tried using dd, as: 1 - # dd bs=1 skip=2 ...
0
votes
0answers
28 views

Unrecoginzed option: using 'getopt' cmd in shell script [on hold]

What is wrong in the command: if ! options=$(getopt -n myscript -l a:,b:,cc:,dd:,ee:,ff:,gg:,hh: -- "$@"); then exit 1; fi I get an error msg: mhagent: unrecognized option '--hh' options=' --aa ...
0
votes
3answers
76 views

Using grep in shell script

I have a text file which looks like this(I am showing few lines of it) INDEX : 1 snRNA_seq:TTTTGGAGCAGGGAGATGGAAT miRNA_seq:CTCCTGACTCCAGGTCCTGTGT target: ...
4
votes
2answers
55 views

How can set a row as column in unix [duplicate]

How can I set a row as column in Unix. Example: name : Keshav sub : C++ branch: cse DOB :22/09/1990 company:NONE name : Vijay sub : Java branch: cse DOB :22/09/1985 company:NONE I want output ...
-1
votes
0answers
15 views

Count Unique values of Variable in Unix [on hold]

I have stored a column value in a variable I want to count unique values in the variable. How can I do this?
1
vote
1answer
33 views

How can I get $PATH to always include $(pwd)/sub_directory/.bin

If the path ~/dev/project1/node_modules/.bin/ionic exists, and my working directory is ~/dev/project1, I would like to be able to just type ionic and hit enter. I could include all those ...
1
vote
1answer
25 views

if command in find -exec

I was just trying to list all directories and files under current directory and also write if they are file or directory with the following command: find -exec echo `echo {} : ;if [ -f {} ]; then ...
1
vote
3answers
110 views

Determining the exit status of the “return” built-in

I was reading about traps, but only return works for me in my shell script, so was wondering what status or code it returns, so what I tried is, #!/bin/bash seeOutput=`return` echo $seeOutput It's ...
0
votes
2answers
28 views

What I am doing wrong with this bash variable? [on hold]

How can I insert a variable into a command? In the case below, I need to concatenate the command with the variable file name. #!/bin/bash # Define a timestamp function timestamp() { date +"%D-%T" ...
3
votes
1answer
233 views

Chaining pipe | with &&

I have this command where I want to filter make output: cd /app && make && sudo nginx -g 'daemon off;' What is the correct way to insert make | pv -q -L 100 here?
-1
votes
2answers
24 views

if else statement

I have a case statement inside some of the if statement, but after doing the case statement inside the if statement, the loop ends. After the case statement, it is supposed to go to the next value on ...
1
vote
0answers
59 views

What is the meaning of the string **/* when used with grep?

I came across this picture (below), obviously it is a pun or some kind of allusion incorporating command-line expressions. Frankly speaking I do not understand anything of it except for grep -n. ...
3
votes
2answers
91 views

BASH: Special character '�' suddenly appeared (Ubuntu)

When I erroneously type 'ñ' (expecting to type any command) and then remove it and type the correct letter, the output returns the command with a special character attached �, obviously the shell ...
0
votes
2answers
30 views

A batch that cout the number of occurrences

I've to extract the number of words using each letter of the alphabet from A to Z. The script that i've to create create take as parameter the name of the dictionary file to analyze and will be used ...
1
vote
1answer
318 views

shell command to know computer manufacturing date [on hold]

as object, I would like to know when a computer was built and also last OS installation date
1
vote
2answers
69 views

Is there any way to make scripts dynamic? [closed]

I need my script to show the time till next run, continuously like a timer, is this possible?
2
votes
2answers
26 views

How can I copy and move a sequential subset of files?

I have a directory containing 1772 files named PRC0001, PRC002,... up to PRC1772. How can I copy a subset, for example PRC0257 to PRC1516 to a different directory? I am trying to do this for several ...
1
vote
3answers
51 views

how to express line feed in shell?

Im my debian7.8 bash shell. str="deb http://ftp.cn.debian.org/debian/ wheezy main contrib non-free \n deb-src http://ftp.cn.debian.org/debian/ wheezy main contrib non-free " echo $str > ...
1
vote
1answer
24 views

How do I control output after executing a command?

.. Script Run Complete. You have new mail in /var/spool/mail/<user-name> -bash-3.2$ I have seen the above message most the times on my prompt, probably while it's idle or as soon as script ...
2
votes
1answer
38 views

Produce aligned columns in a shell script

In shell how do I have an even length of spaces by the length of words on my menu? I've tried to get the length of the longest character string and then create each column length by the longest ...
0
votes
1answer
29 views

How can I multiply a column by a variable and write out? [duplicate]

I would like to multiply a single column in a .txt file by a variable and then write to another .txt file. What am I missing from the awk line? Appreciate any help in advance. !/bin/bash ...
2
votes
1answer
35 views

Can we use two brace expansions together?

For example, I want to rename a file abc to bd. Why doesn't two brace expansions work? How shall I make brace expansion work in my example? Thanks. $ touch abc $ mv {a,}b{c,d} mv: target `bd' is not ...
1
vote
3answers
68 views

How do you parse through a subdirectory where the path contains spaces? [duplicate]

I'm trying to parse through a set of files in a directory on a mapped drive. However, I can't seem to resolve an issue that seems to be because of spaces in the path to the subdirectory. Would ...
-3
votes
0answers
23 views

How to configure the Shell if no .bashrc exist ?

I have a problem with my Xfce Terminal, once I start it it does not respond for a minute. I was told here to change settings in the .bashrc configuration file. Unfortunately no such file exist. What ...
-2
votes
2answers
35 views

Not able to run shell script using cron [closed]

I have a shell script test.sh in /home/username The test.sh file contains the following lines - #!/bin/sh cd /home/username/bin sh launch.sh ParameterName #launch.sh is in /home/username/bin ...
3
votes
1answer
138 views

eval limitation with piped commands

We have a shell script that builds a long piped command chain in a variable and executes it with eval (the following code is simplified to the essential): cmd="cat /some/files | grep -v \"this\" | ...
1
vote
4answers
4k views

monitoring file changes + process access to files

I would like to see what's happening in my app server folders, which files are changed by process x or which *.war files has been changed (replaced/created) in last x minutes. I am software developer ...
0
votes
1answer
43 views

property file reading from unix shell [closed]

Below is the sample code. products=$PRODUCTS arr=$(echo $products | tr "," "\n") for x in $arr do with="${x}SUBPRODUCTS" subproducts=$(echo "${x}SUBPRODUCTS") echo ...
6
votes
5answers
117 views

execute a command in $PATH matching a wildcard

I'd like to find and execute a command in the current $PATH matching this wildcard libreoffice?.? (eg. libreoffice4.0, libreoffice4.3, etc.) EDIT: if multiple matches are found, you can pick one ...
0
votes
1answer
41 views

Shell Concat string from config file

I have created config.cfg like this DB_USERNAME='abcdef' DB_PASSWORD='1234' Then my shell.sh have read config and try to concat string #! /bin/sh source config.cfg ...