sed is a command-line stream editor for filtering and transforming text.

learn more… | top users | synonyms

3
votes
4answers
5k views

How to get all lines between first and last occurrences of patterns?

How can I trim a file (well input stream) so that I only get the lines ranging from the first occurrence of pattern foo to the last occurrence of pattern bar? For instance consider the following ...
3
votes
4answers
460 views

Piping paths with different types of quotes for slash substitution

I would like to use sed to convert a path with backslashes to the same path with forward slashes: E.g. I would like to pipe \\path\to\file\ and obtain /path/to/file None of the following commands ...
3
votes
1answer
7k views

Delete specific line number(s) from a text file using sed?

I want to delete one or more specific line numbers from a file. How would I do this using sed?
3
votes
4answers
944 views

Strip spaces after single capital letters with sed

I am writing a bash script to automatically generate some other files, and I have to format some strings a certain way. Specifically, the last problem I'm having is formatting a string that has ...
3
votes
2answers
6k views

Strip trailing whitespace from files

The answer to removing trailing whitespace with sed has most of the answer, but I want sed -i 's/[ \t]*$//' $1 to be able to take arbitrary number of file arguments as a shell script on the command ...
3
votes
2answers
720 views

How do remove identical lines in one file from another, using sed?

I have two files, one being a superset of the other. I want to remove the identical lines in the smaller files from the larger file. One possible complication is that the lines contain backslashes. ...
3
votes
4answers
150 views

tab separation of the file

I have a file with seq likes this ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT ...
3
votes
2answers
3k views

Why does sed outputs “char 53: unterminated `s' command”

Why this bash script ssh $SERVER bash <<EOF sed -i "s/database_name: [^ ]*/database_name: kartable_$ME" $PARAM_FILE exit EOF output -> sed: -e expression #1, char 53: unterminated `s' ...
3
votes
2answers
1k views

Search a string with last two characters as numeric

Suppose I have a file like this: adasfddfd09 dsassd90897 323sdsdsdsd sdddsdf56 dfdf45fdfdf I want to search only those strings which have last two characters numeric with sed, grep and awk.
3
votes
1answer
1k views

grep on line before the match plus the match

zzzzzzzzz aaaaaaaaa bbbbbbbbb & ccccccccc & ddddddddd hhhhhhhhh eeeeeeeee fffffffff & ggggggggg & in the above line, what i want is to grep/sed/awk (any method is fine) line that ...
3
votes
3answers
102 views

How to select 30 files and do a bunch of sed commands on them

I want new copies of the files, so I want to do something like: dir *.rb foreach file make a copy of the file, e.g. 'blob.rb' to 'blob_processed.rb' do the 50 sed commands to process the ...
3
votes
3answers
208 views

checking data in columns when a data or some may be missing or present?

I am not sure if this possible. say i have columns like : Team Colour Game Rainfall PlayerName XYZ Blue Cricket Yes Kapil suppose i need to search ...
3
votes
5answers
714 views

changing pattern of a text file

A text file has contents something like chair table pen desk Now i want it to be changed and stored in a variable say var as below ('chair','chair'),('table','table'),('pen','pen'),('desk','desk') ...
3
votes
2answers
714 views

Replacing lines containing a pattern with sed

How can I replace a given character in a line matching a pattern with sed? For example: I'd like to match every line beginning with a letter, and replace the newline at the end with a tab. I'm trying ...
3
votes
3answers
313 views

String replacement in file

I have the following file: <?xml version="1.0" encoding="utf-8"?> <!--Generated by crowdin.net--> <string name="test" >- test</string> <string name="test" ...
3
votes
6answers
970 views

sed remove characters from new line

After some processing, I have my input file like below. file1.txt 12345|john|student 43321|jack|professor 78965|alex|lecturer I need to process the above file further and so I need a line ...
3
votes
4answers
608 views

extract the characters before () using grep

I need to extract the characters before the character '('. My file structure is: rose(good)ook daisy()no lilly(bad)fine sunflower()nice I need output file as in the form of: rose ...
3
votes
3answers
2k views

awk remove the rows based on another column value

I have a file like below which I have sorted based on the username field. UserID score UserName 1234 200 Jack 5678 150 Jill 8543 200 Jill 5678 100 John I am trying to remove ...
3
votes
4answers
7k views

extract only the substring after double quotes - grep

I have a file which is as below. <a href="http://firstlink.com" title="title1"> <a href="http://secondlink.com" title="title2"> <a href="http://thirdlink.com" title="title3"> <a ...
3
votes
5answers
196 views

grep device name and look for next value :

I have this output from a find command: abc,10.11.13.14,def,1.2.3.4,geh,6.7.54.23 where abc,def and geh are device names and could be of any length and others are IP address belong to devices. ...
3
votes
3answers
2k views

Average rows with same first column

Given a file with two columns: Id ht 510 69 510 67 510 65 5l0 62 510 59 601 29 601 26 601 21 601 20 I need a way to coalesce all rows with the same ID into one that has an average height. In this ...
3
votes
6answers
223 views

Extracting help message from script itself

I want that my help message be extracted from the script itself. #!/bin/bash # # foo - do things # Author: John Doe <jhon@doe> # ---------------------------------------------- # SYNOPSIS # ...
3
votes
4answers
464 views

Align a hex text file at 9 bytes each line

I want to align the selected portion of a text file at 9 bytes each column. For example suppose my text file looks like below. 00 2f c6 b8 29 fd 02 37 11 00 9f 74 34 0b 60 72 38 20 00 9e 61 33 8e ...
3
votes
4answers
537 views

Adding a TeX macro to the beginning of a file using sed (why doesn't my method work?)

I need to add a line to the beginning of a file. The line in question is \def\submit{} I've got a semi-working solution using sed. I don't know sed, but got it from somewhere on the net, but it ...
3
votes
4answers
166 views

pattern match and capturing in unix

I have a file like this: A1-1915435_1_MIMAT0000069_MirBase_miR-16_microRNA_1_22-A1-1915435_1_ENSG00000206737_ENST00000384010_U1_snRNA_73_115 ...
3
votes
3answers
2k views

Extracting part of lines with specific pattern using awk,sed

I have a question regarding the awk/sed operators. I have a big file which has following set of lines repeated Expression loweWallrhoPhi : sum=-6.97168e-09 Expression leftWallrhoPhi : ...
3
votes
2answers
217 views

How to add new lines from another file with sed

I'm trying to find the sed command so that I can put filename into filename1. These are my two separate files. INPUT filename has: Cindy 11 22 54 Chester 48 12 84 INPUT filename1 has: Name ...
3
votes
2answers
561 views

Get text between a word and the last line?

According to the answers in Stack Overflow question How to use sed/grep to extract text between two words?, we can get text between two words: sed -n "/first/,/second/p" file But what if I want to ...
3
votes
3answers
143 views

“Tuning” tr and sed expression

I have MD5 file which lists filename and MD5 sum in the following way: MD5 (file14n0001.xml.gz) = 04eb2524d271077ec8f1a0021779b171 MD5 (file14n0002.xml.gz) = 07e2b29645e9211cce9daf1ae27e7b99 MD5 ...
3
votes
2answers
666 views

Counting comma separated characters in a row

How can I count how many elements are separated with comma in a given column of a file (tab_delimited), using awk or sed? Exemple: AC 1,23,5 DC 2,8,89 Would return: AC 3 DC 3
3
votes
4answers
343 views

Use the sed command to search text file for entries 10000 and under

I'm trying to use the sed command to search a file for all entries 10000 and under but I think this incomplete sed search string might be for entries 10000 and over: sed -n ...
3
votes
2answers
2k views

How can I print out all but the last n characters in bash?

I'm working with standard input (cating two files together) and want all but the last 10 characters of the result to be passed through the next command. All I can find through searching is using sed, ...
3
votes
3answers
311 views

sed - how to (not) match unmatched brackets

How can I do my operation only on lines that close their brackets? For example I want to change ".is" lines and add a bracket but not for lines with unclosed brackets. so these are changed ...
3
votes
1answer
656 views

Efficient way to print lines from a massive file using awk, sed, or something else? [duplicate]

If I had a plain-text file containing 8 million lines and I want to print out lines 4,000,010 to 4,000,000 to the screen, which would be more efficient: awk or sed? There is no pattern to the text, ...
3
votes
5answers
3k views

How to remove duplicate letters using sed?

Using sed, how can I remove duplicate letters from HEADERS within a text file? NNAAMMEE nice - run a program with modified scheduling priority SSYYNNOOPPSSIISS nice [-n ...
3
votes
4answers
2k views

Removing unwanted lines in text file

All I need is the sed or awk code to remove the even numbered lines in a text file. Nothing fancy I just need to remove irrelevant data on the even lines of a text file.
3
votes
4answers
447 views

Replace all occurences of \ except \N

I have a file like this: 1,2,subjects,\mat\hs,unix\,\Nato,\N,123,\N I want to replace all occurences of \ with #, except for \N, such that the output looks like this: ...
3
votes
3answers
104 views

how to form a sed expression containing escaped characters

Given a sed expression (and GNU sed 4.2.2 on ArchLinux) /match/i\tline1\n\tline2 which should insert two tab-indented lines above the match, I find that the escaping of the first character (in the ...
3
votes
7answers
2k views

Is there a faster way to remove a line (given a line number) from a file?

A related question is here. I often have to edit a large file by removing a few lines from the middle of it. I know which lines I wish to remove and I typically do the following: sed ...
3
votes
2answers
853 views

Colorizing tail output with sed

How would I go about colorizing the output of tail with sed? echo "`tput setaf 1`foo`tput op`" works as expected echo "foo" | sed -e 's/(foo)/`tput setaf 1`\0`tput op`/g' however, does not. What am ...
3
votes
4answers
614 views

Delete a block of lines with a condition on the last line

I have a log-file where at the end of a series of lines you can see if this block is relevant. Now I'm looking for a command like sed to delete de blocks ending with "Content-Length: 0" and beginning ...
3
votes
2answers
2k views

What is the best way to find a list of several strings within a large text file

The short, general question is: In Unix/Linux, what is the best way to find a list of several (about 150) strings within a large text file? I am asking this to all Unix/Linux experts as a general ...
3
votes
2answers
558 views

Parsing a text-file table and aggregating information

I have long text file with the following columns, space-delimited: Id Pos Ref Var Cn SF:R1 SR He Ho NC cm|371443199 22 G A R Pass:8 0 1 0 0 ...
3
votes
2answers
100 views

What is the usage of pattern before substitute command in sed

There is an example in this link about sed: To delete the first number on all lines that start with a "#" use: sed '/^#/ s/[0-9][0-9]*//' What is the benefit of first pattern(/^#/)? It could be ...
3
votes
5answers
173 views

Pick the latest file based upon the sequence number given in the file name

I have a requirement, I have few files in a directory, I need to pick the oldest one for processing. For Exp: I have below files in /tmp directory: Sample_0000237826-001_xyz.dat ...
3
votes
2answers
179 views

Find the line number which contains the pattern with custom delimiter

As in example I'm trying to get line numbers which contains the pattern. My pattern contains slashes so I wanted to add custom delimiter. This simple one works: sed -n '/file/=' temp.txt Using ...
3
votes
2answers
4k views

sed: substitute text with a string that contains special characters

I have a lot of text file with specific tag called "Comment", example I have a file called 3dchess.sh, I need change the tag: Comment=3D chess for X11 to Comment='<span ...
3
votes
1answer
134 views

Can someone clarify this Bash script

I'm learning something about Bash scripting, and I came across this example: The task is to write a Bash script that reads a file, given with the first argument, pulls out those records that have the ...
3
votes
2answers
377 views

Print row contain maximum and minimum value

I need to read the file (contains 16K rows)and print the entire row if any of columns and all columns contains max value (100) and all columns contain min value (0).The ouput example is given ...
3
votes
3answers
14k views

Sed : Replace pattern on every second occurence?

Is there a way to tell sed to replace the pattern on every second occurrence? Or at least on every second line? (Sure it's possible with a script, but I was asking myself if sed can do it to). ...