sed is a command-line stream editor for filtering and transforming text.

learn more… | top users | synonyms

1
vote
1answer
170 views

remove lines where a field's value is less than or equal to 3 - sed or awk?

I need to remove every line that has a value of 2 or less in the 8th field (column). My data looks like this: 12-31 Airport 189 379 41 49.70946503 -124.91377258 2 2880 30.8 01-01 ...
1
vote
1answer
45 views

How to replace string of the file, which is present in tar file through UNIX

I have a tar archive xyz.tar containing lots of .sh files like: 123.sh 456.sh 789.sh Every .sh file has some string content, e.g. 123.sh contains welcome to Hollywood, 456.sh contains I love ...
3
votes
5answers
216 views

Pick the latest file based upon the sequence number given in the file name

I have a requirement, I have few files in a directory, I need to pick the oldest one for processing. For Exp: I have below files in /tmp directory: Sample_0000237826-001_xyz.dat ...
10
votes
3answers
1k views

How do I replace the last occurrence of a character in a string using sed?

How do I replace only the last occurrence of "-" in a string with a space using sed? For example: echo $MASTER_DISK_RELEASE swp-RedHat-Linux-OS-5.5.0.0-03 but I want to get the following output ( ...
0
votes
1answer
66 views

Error with sed on MAC OS X invalid command u

Im french sorry in advance for my bad english... So i have an error on MAC OS X when im using sed sed -i '' '/user_pref("mail.identity.id1.reply_on_top", 1);/ a\ ...
6
votes
3answers
356 views

Sed alternative for search and replace on very long lines

I have files that were generated by a program that did not put newlines at the end of records. I want to put newlines between the records, and I can do so with a simple sed script: sed -e ...
2
votes
3answers
3k views

How to escape a single quote? [duplicate]

This works fine: sed -i 's# @driver.find_element(:xpath, "//a\[contains(@href,##' temp_spec.rb against a source of @driver.find_element(:xpath, "//a[contains(@href,'change_district')]").click ...
1
vote
0answers
77 views

Sed regex printing into a file.txt

I'm connected to a MQTT stream, and I filter out the data by entering : mosquitto_sub -d -t +/# 2>&1 | sed -n "/PUBLISH/{s|.*\('.*',\).*|\1$(date),|;N;s/\n//;p}" into the Ubuntu terminal. ...
0
votes
1answer
48 views

Why does the input to xargs is 1 string but without is strings in separate line?

I am trying to pipe file to rm via xargs. I understand that what I am tryng to do could be done by git clean but I am practicing the cli. I tried this: for files in $(git status --porcelain| sed ...
2
votes
2answers
3k views

Swap two columns in a CSV using SED

I have a CSV file that contains 10 different fields (, is the deliminator). Example data: student-id,last,first,hwk1,hwk2,hwk3,exam1,hwk4,hwk5,exam2 pts-avail,,,100,150,100,200,150,100,300 ...
0
votes
3answers
50 views

Separating names separated by “| character” to individual pairs

I want to separate the names in the same line into separate individual pairs. TMPRSS2|pp9284 AADAT Sample1 ERG TMPRSS2|pp9284 Sample2 TMPRSS2|pp9284 ETV1 Sample3 PDE4A ...
0
votes
3answers
68 views

Awk/sed command to cut on multiple delimiters [closed]

I have input file name as: Sample_0000860156-001-out_20150224150524.xml.gz I want only 0000860156-001 from the file_name to append to my target file name.
7
votes
4answers
236 views

Matching and pasting to line

So I have 2 very big text files, consisting of lines like so: First: Robert:Dillain:Other:Other:Other Julian:Brude:Other:Other:Other Megan:Flikk:Other:Other:Other Samantha:Minot:Other:Other:Other ...
0
votes
1answer
36 views

problem with sed inside sed

i am trying to parse a string inside a sed command but i am getting errors. if some1 can help me... it would be nice. i dunno what else to try sed -e "/pd begin $(echo 3:1I:1:1|sed 0,/:/{s/:/' ...
-4
votes
1answer
33 views

Remove characters from string with sed [closed]

I have this header: >tr|G3Q381|G3Q381_GASAC Uncharacterized protein OS=Gasterosteus aculeatus PE=4 SV=1 and I was thankfully helped on here to get it to: >G3Q381_GASAC but now I need to ...
6
votes
4answers
23k views

Can sed replace new line characters?

Is there an issue with sed and new line character? I have a file test.txt with the following contents aaaaa bbbbb ccccc ddddd The following does not work: sed -r -i 's/\n/,/g' test.txt ...
0
votes
0answers
37 views

SED and regex expressions… addr1 and addr2

How can I use sed to match 'addr1' and reuse it again in 'addr2' field? #Ex.: echo "12a34" | sed 's/a/#bcd/g' # 12abcd34 #\# = match addr1
2
votes
3answers
85 views

how to use awk/cut to get column data which has space

I have data in below format: 16 SQL*Plus vilconv1 dox-conv2 16 TOAD background query session Disha WORKGROUP\AD now I want to ...
0
votes
1answer
54 views

How to change a single line in multiple files [duplicate]

I have ~750 .php files in the same directory that contain the line include("path/to/file.php"); I would like to change this line in every file to require_once("path/to/file.php"); What would be ...
3
votes
3answers
49 views

sed command and formatting one line help

I need help turning these headers: '>>tr|G1PEZ0|G1PEZ0_MYOLU Uncharacterized protein (Fragment) OS=Myotis lucifugus GN=SNCG PE=4 SV=1 into just this: '>G1PEZ0_MYOLU I've given up. I ...
1
vote
1answer
60 views

Single record of a file getting splitted over multiple lines

We are using flat text files to store in teradata table after transformations from Informatica. The file contains 14 fields (~ separated). But as the records are getting scattered over multiple lines ...
2
votes
1answer
55 views

Replacing by tab character in Sed in Osx

I am working in Mac OS X,I have tried several commands in sed to replace by a tab character followed by a file name. for f in *.txt; do sed -i '' -e "s/$/\t$f/g" $f; done for f in *.txt; do sed -i ...
3
votes
3answers
10k views

Insert text in specific lines of a file?

How can insert some text in specific lines of a file? What is most simplest method that I can use? (bash, sed, awk?) What I want to do, might be simple, but I don't know where I should start. It's ...
0
votes
1answer
64 views

Space removal after a pattern in SED

I have a file instrument.xml bash-4.1$ more instrument.xml <instr instr_id="CPT-2380950-011-001-826" valor_ch="" instr_type="CurrentAccount" instr_name="CPT-2380950-011-001-826" qn_type="1" ...
-1
votes
1answer
90 views

replace text in a file

are there any usefull command to replace all text that contain number and remove those number . Ex: myimages-202x250.jpg width="202" heignt="250" replace to myimages.jpg width="217" height="317" ...
5
votes
5answers
382 views

How to run a command only if sed replace strings

I want to enable multiverse repository in Ubuntu by a command line. sed -i "/^# deb.*multiverse/ s/^# //" /etc/apt/sources.list && apt-get update This command will run apt-get update every ...
1
vote
4answers
92 views

Replacing pattern with variable

I have 3 lines of numbers stored in a variable $new and I need to use this to replace 3 lines from a file which I have used grep and stored in another variable $old. I'm trying sed "s/$old/$new/g" ...
3
votes
4answers
160 views

Replace a marker in a text file with arbitrary new text

I have a file which contains some text and - on a single line - a marker which indicates where new content should be added foo bar %SUBSTITUTE% foo The line line substitute should be replaced by a ...
3
votes
5answers
2k views

Replacing text from a list of replacements. Added complication: backslashes

I have a file A that contains pairs of strings, one per line: \old1 \new1 \old2 \new2 ..... I would like to iterate over file A, and for each line perform the replacement (e.g. "\old1 -> \new1") ...
1
vote
3answers
41 views

Print more than one line from a text file

I am using the following code to print the second line from a file: sed '2q;d' file what can I add to this code so I can print two or more lines at once?
0
votes
3answers
432 views

How to delete html tags from a file using sed ?

I have a file that is mixed with both normal text I need and html-tags. I know that with REGEX it is possible to recognize html tags and with sed one can swap those for an empty string, but I do not ...
2
votes
1answer
53 views

how can I add an extra character after a word search [closed]

I have the following field names demelog voyapro naisjdf naismc decoide decoccm travide travccm equiccm mariccm Below is a sample of my file. There are more columns before the first fck=83... ...
1
vote
1answer
186 views

grep (/sed/awk) month range

I've looked around for solutions to this, but it's sort of difficult to search for the solution to such a specific problem (lot of words to put in Google). So, I have a file with data that looks like ...
1
vote
3answers
53 views

How to replace string with abc\\efg[255 with abc\\efg[23 using sed

I have a file and it has lines starting with abc. How can I replace the string abc\\efg[255 with abc\\efg[28 using sed?
4
votes
2answers
80 views

How to “grep” for line length in a given range?

I need to get only the lines from a textfile (a wordlist, separated with newline) that has a length range of minimum or equal than 3 characters, but not longer or equal then 10. Example: INPUT: ...
4
votes
3answers
136 views

How can I find and replace only if a match forms a whole word?

My script is: n="y" while [ "{n}" = "y" ] if [ $n == "n" ]; then break; fi echo "n is $n" do read -p "Enter the word to find = " word read -p "Enter word to replace = " replace ...
1
vote
2answers
393 views

extract blocks of text from xml file

I have a file with these contents: <People> <Person> <Name>Joe Blogs</Name> <Address>55 Oxford St</Address> ...lots of other properties ...
1
vote
1answer
51 views

Create files from templates, substitutions in middle of other words

Is there a way to convince m4 to replace a macro in the middle of a word? I would like this file, day.m4: define(Sat,Cat)dnl Saturday and this command: m4 day.m4 to produce this output: ...
0
votes
2answers
81 views

what are considered old and powerfull commands? [closed]

I came across the terms awk and sed, awk goes once through all lines and performs a task whenever a line meets a certain condition, sed can manipulate a stream of input before it goes further to the ...
4
votes
3answers
230 views

Can tr commands be chained to avoid multiple tr processes in a pipeline?

I have a bunch of txt files, I'd like to output them lower-cased, only alphabetic and one word-per line, I can do it with several tr commands in a pipeline like this: tr -d '[:punct:]' ...
0
votes
1answer
50 views

Regex for matchng anything between parenthesis

I have the following regex so far: printf "this is (test.com)\n" | grep -Po '(?<=\().*(?=\))' The above regex will print the desired output, which is test.com As far as I am adding new ...
9
votes
3answers
15k views

Extracting a regex matched with 'sed' without printing the surrounding characters

To all the 'sed' doctors out there: I have a seemingly trivial 'sed' question to which I have not been able to find a solution. How can you get 'sed' to exctract a regular expression it has matched ...
-1
votes
1answer
723 views

search for a character in one column and replace value in another column of matched records

I have a requirement to find value 2 in column 4 and wherever it matches replace 6th column with '-'sign in the beginning suppose if i have csv file - file1 like this abc,0,def,1234,ijk ...
1
vote
2answers
101 views

Remove a line if regex exists only in 1st column of each line in a csv file

I have the following comma-delimited data (spaces used for visual clarity): 1 2014 23 2352 19.24 7.18 1 2014 23 2353 19.78 4.65 24 2014 23 2354 20.26 25.34 1 2014 23 2355 26.65 42.76 1 2014 23 ...
1
vote
2answers
49 views

Using `sed` in Android without `g` modifier?

I have Stericson busy box installed in my rooted Nexus 10. I wanted to replace the first instance of </verse-sub-section> with </section> in the file here: <section>Psalm ...
2
votes
2answers
41 views
0
votes
0answers
13 views

how to keep the spaces when inserting line to parameter [duplicate]

When I want to see for example the line number 2 , from the CSV file I get the following line example1 LINE_NUM=2 # sed -n "${LINE_NUM}p" file.csv cwdfwefwe,"aaaaa ","\dsw\dawd\aw ...
8
votes
4answers
560 views

Output part of each line to a separate file

I have a file like this: a AGTACTTCCAGGAACGGTGCACTCTCC b ATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCATGCTCCAT c ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCATGCTCCATCCACTCCACAC d ...
1
vote
3answers
94 views

How do I replace a string with dollar sign in sed?

I want to replace this string: export TODO_FILE="$TODO_DIR/todo.txt with: export TODO_FILE="$TODO_DIR/writing.txt" in the file ~/.todo/config. I've run it with: sed -i 's/export ...
1
vote
1answer
60 views

sed regex not working for hidden characters

I have a list that has for some reason got some non alphanumeric characters appended to the end. I would have thought it would be a simple case of running : sed 's/[^A-Za-z0-9]$//' To replace ...