sed is a command-line stream editor for filtering and transforming text.

learn more… | top users | synonyms

-1
votes
1answer
571 views

search for a character in one column and replace value in another column of matched records

I have a requirement to find value 2 in column 4 and wherever it matches replace 6th column with '-'sign in the beginning suppose if i have csv file - file1 like this abc,0,def,1234,ijk ...
1
vote
2answers
93 views

Remove a line if regex exists only in 1st column of each line in a csv file

I have the following comma-delimited data (spaces used for visual clarity): 1 2014 23 2352 19.24 7.18 1 2014 23 2353 19.78 4.65 24 2014 23 2354 20.26 25.34 1 2014 23 2355 26.65 42.76 1 2014 23 ...
1
vote
2answers
34 views

Using `sed` in Android without `g` modifier?

I have Stericson busy box installed in my rooted Nexus 10. I wanted to replace the first instance of </verse-sub-section> with </section> in the file here: <section>Psalm ...
2
votes
2answers
39 views
0
votes
0answers
13 views

how to keep the spaces when inserting line to parameter [duplicate]

When I want to see for example the line number 2 , from the CSV file I get the following line example1 LINE_NUM=2 # sed -n "${LINE_NUM}p" file.csv cwdfwefwe,"aaaaa ","\dsw\dawd\aw ...
8
votes
4answers
499 views

Output part of each line to a separate file

I have a file like this: a AGTACTTCCAGGAACGGTGCACTCTCC b ATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCATGCTCCAT c ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCATGCTCCATCCACTCCACAC d ...
1
vote
3answers
75 views

How do I replace a string with dollar sign in sed?

I want to replace this string: export TODO_FILE="$TODO_DIR/todo.txt with: export TODO_FILE="$TODO_DIR/writing.txt" in the file ~/.todo/config. I've run it with: sed -i 's/export ...
1
vote
1answer
54 views

sed regex not working for hidden characters

I have a list that has for some reason got some non alphanumeric characters appended to the end. I would have thought it would be a simple case of running : sed 's/[^A-Za-z0-9]$//' To replace ...
0
votes
3answers
293 views

create XML file using bash script

I want create simple xml file using bash script ( not with dom ) but when I set value in the line then echo print the $lorem word and not the val lorem=LOL echo '<root><foo ...
0
votes
1answer
82 views

Reading a string till a key word and replacing from there with another string

I am new to UNIX and am practising shell scripting. I have an application where I need string searching and replacement. There are some lines in a file 1 and file 2. I have a search key word. If the ...
0
votes
3answers
102 views

Using sed to remove digit separation commas enclosed in quotes and quotes itself from CSV? [duplicate]

How can I can use sed to remove from before-last column the group digit char comma and quotes itself? Please note that in the sample below the target column is not contained in double quotes. ...
1
vote
3answers
190 views

sed won't expand my BASH variable in script

I have this script, which will prompt for the relative or absolute path to the file and then swap whitespaces ' ' with '\ ' which works in Linux console. Substitution is done using the first sed ...
2
votes
2answers
115 views

How do I have sed only perform actions on the first match?

I have a bash script that extracts headers from the MIME Source of an email. The idea is that I only want to capture the headers of the message nothing else. It's not quite working right though. I ...
0
votes
0answers
50 views

Bash - Convert escape character colored text to BBCode

I want to convert a terminal escape-character colored text file to BBCode colored text. For this i've created an Android logfile with logcat -Cd > /sdcard/logcat.txt. The -C switch adds the color ...
7
votes
4answers
11k views

Copy/rename multiple files using regular expression (shell script)

I have a collection of files matching a pattern such as 'assignment02.cc', 'assignment02.h', 'assignment02.txt', etc. I would like to copy/rename these files into 'assignment03.cc', 'assignment03.h', ...
0
votes
5answers
84 views

sed to replace with backspace

I have trail.txt, which contains spice netlist. Now I want to replace all expanded parameters to one line only i.e. remove + and append that line to previous line. trail.txt data + net06706 ...
0
votes
1answer
24 views

Coordinates X237595Y81600 to X2375Y8160

I have create a gerber file and it has lines inside which look like this: X90095Y15350 X100095Y15350 X110095Y15350 X120095Y15350 X120095Y25350 X110095Y25350 X100095Y25350 X90095Y25350 X80095Y25350 ...
0
votes
2answers
95 views

sed to replace a word from a file with the contents of another file? [duplicate]

I have two files file1 & file2. Contents of file1: Text1 Text2 Text3 Contents of file2: Sample1 Sample2 Sample3 I would like to replace the word Text1 from file1 with the contents of ...
0
votes
1answer
39 views

Sed with angle brackets

This works sed 's/[[:space:]]*<default>false/XXX/' Why does prepending a > make it fail sed 's/>[[:space:]]*<default>false/XXX/' escaping the > does not help either. In ...
1
vote
1answer
59 views

How to add the content of a text file to the middle of another text file

I tried to use sed, but I realized that it doesn't allow to charge a complete file. I am looking for a quick and neat way to: a.txt a b c b.txt d e f And obtain c.txt a d e f b c
1
vote
2answers
43 views

Generate Sequence number for each line at the end .. modified t he post can someone help&suggest on this

I am new to linux I have got this query sed '/./=' abc.txt| sed '/./N; s/\n/, /' >> as.dat source file has 3 rows like below a b c When use the following command it gives me result like ...
4
votes
1answer
165 views

sed command inside sed

Is it possible to run sed command inside sed, something like this: sed -i.bak -e '${sed -n 1,1p file.txt},$d' output.file I want first line of file.txt which is number to be input parameter for ...
5
votes
2answers
404 views

sed: read whole file into pattern space without failing on single-line input

Reading a whole file into pattern space is useful for substituting newlines, &c. and there are many instances advising the following: sed ':a;N;$!ba; [commands...]' However, it fails if the ...
8
votes
1answer
286 views

regarding portable sed -e… d b or ! b?

In this edit Stéphane Chazelas POSIXifies (again) my sed formatting by inserting an -expression break and another -expression statement. Now, I might just ask him why in the comments, I suppose, but ...
0
votes
1answer
97 views

regex find replace strings starting or beginning with backslash

I have a compilation album in my music library that has song titles in the form of ARTIST/ TITLE, which is making it really difficult to cp or mv these files because of the slash. So I'd like to ...
3
votes
3answers
70 views

Append and write out variable-named file from list of variables

I would like to create multiple 'wget' shell scripts to download a batch of considerably large (~3GB) files using our HPC cluster. The names of the files are stored in filenames.txt, like so: $cat ...
3
votes
2answers
173 views

Capture in shell variables the arguments after a command (between brackets)

Suppose I have a file that contains, among many other things, \command{arg1,arg2,arg3} (arguments been paths, expressed with /, ., characters and numbers) But that a user can as well call it ...
1
vote
1answer
999 views

sed: N command does not read single line

Why sed's N command does not read single line? # single line without \n $ echo -en 'abc' | sed -n 'N;p' $ # I expected 'abc' # single line with \n $ echo -en 'abc\n' | sed -n 'N;p' $ # I expected ...
3
votes
5answers
214 views

How to replace only the third occurrence of the file in unix using only sed command?

How to replace the third occurrence of the string in the file using sed command. Example: Change only the third occurrence of is to us in the file. My input file contains: hai this is linux. hai ...
1
vote
2answers
72 views

Copy the first 2 lines from a file and then remove the lines

I need to process a file using a shell script. The file arrives with the data as well as some embedded information releavant to how it is processed. The file is in the following format; ...
1
vote
1answer
56 views

split line based on space and delete the second part

I have a big file >fid|29290408|locus|VBIEntCas2262_0001| Phosphoglycolate phosphatase (EC 3.1.3.18) [Enterococcus casseliflavus EC20] ...
3
votes
4answers
3k views

Removing unwanted lines in text file

All I need is the sed or awk code to remove the even numbered lines in a text file. Nothing fancy I just need to remove irrelevant data on the even lines of a text file.
1
vote
2answers
44 views

Why does regex with \\$\{ work with egrep, but not with sed?

Given a text like this ./RFF_09 -f${FILE} -c${COND} inside a file, this egrep command will correctly match: egrep './RFF(.*) (.*)-c\\$\{COND\}' file but this sed command will not sed -n ...
1
vote
3answers
69 views

Removing mulitple lines

I am trying to write up a command line interfaces that will removes a particular section / lines of codes within a list of json files. By the way, the json file are located within the sub-folders of ...
2
votes
3answers
95 views

Adding text to beginning of text file

I am trying to add a line of text to the beginning of a text file (Actually not text, but just two backslashes). I am trying the following, which I found in this answer: Add lines to the beginning and ...
3
votes
7answers
585 views

can we print the last word of each line in linux using sed command?

suppose , if there is a file consisting of following lines , if they are 12345 567 7878 66 er3 t45t y6y46y 4y6 y656y y5y 46y6 65y7 y66uyuy yy46y6y The output has to look like: 66 ...
0
votes
2answers
173 views

How to convert Log file to CSV using bash

Is it possible to turn this log entry into a properly formatted csv file using sed/awk? I've tried multiple ways to do this using sed/awk. Alas I couldn't do it. Before I do it in perl. is this ...
0
votes
1answer
24 views

Insert space at specified position in a file

I have this sample file: 234234|111||J1X0H8|SERP||R|D|666|M 234235|222||J1X0N5|SERP||C||555|M For each line, I need to insert a space after the 3rd character of the 4th column, like so: ...
10
votes
4answers
6k views

How to insert a new line after every second line?

sed/bash/wharever :D INPUT: sadf asdf yxcv cxv eqrt asdf OUTPUT: sadf asdf yxcv cxv eqrt asdf
2
votes
3answers
165 views

Replace multiline string in files

I have a number of files I want to update by replacing one multi-line string with another multi-line string. Something along the lines of: * Some text, * something else * another thing And I want ...
2
votes
4answers
63 views

Removing an empty line and the line above it

I have a large .fna file containing millions of DNA sequences. Due to some write errors after truncating my primers, I'm left with some sequence headers with no sequence following it. An example is ...
38
votes
3answers
72k views

What characters do I need to escape when using sed in a sh script?

Take the following script: #!/bin/sh sed 's/(127\.0\.1\.1)\s/\1/' [some file] If I try to run this in sh (dash here), it'll fail because of the parentheses, which need to be escaped. But I don't ...
3
votes
3answers
240 views

sed fails to remove newline character

I've been using sed for quite some time but here is a quirk I came around with, which I am not able to resolve. Let me explain my problem with the actual case. Scene#1 printf "ls" | xclip ...
0
votes
3answers
60 views

how to replace a character within in a multiple double quoted words within a line using sed?

I have text file including text format like this. 012345,"[ThinkPadT2/3Gband,Mac]",Lenovo,"iPhone3G,A1241" How do i replace comma inside words only within double quote by pipe(|) operator using ...
4
votes
2answers
167 views

sed “e” and “g” flags not working together

Given this: echo AAA | sed -r 's/A/echo B/ge' I get this: Becho Becho B I would have thought I would get "BBB". This is with GNU sed version 4.2.1. What is going on, and how can I use the ...
4
votes
3answers
53 views

How to select first occurrence between two patterns including them

How can I select first occurrence between two patterns including them. Preferably using sed or awk. I have: text something P1 something content1 content2 something P2 something text something P1 ...
0
votes
0answers
14 views

Escape ampersand in bash variable used as a sed argument [duplicate]

I have a template Hello NAME welcome and want to replace NAME with data like "Judy&Mary". Why does this not work? TEMPLATE="Hello NAME welcome" DATA="Judy&Mary" echo $TEMPLATE | sed -e ...
1
vote
1answer
46 views

How can I use regex to extract the text following two conditions into a variable?

I'd like to extract a setting for a given host in the ssh_config file and put it into a variable. Host mysite HostName 123.1.1.1 User myuser Port 13245 GSSAPIAuthentication no ...
1
vote
2answers
83 views

Formatting ifconfig using sed/awk

I'm using ifconfig on OpenSUSE. When I run ifconfig eth0 I get eth0 Link encap:Ethernet HWaddr CE:FD:75:DF:A5:6D inet addr:172.16.4.177 Bcast:172.16.5.255 Mask:255.255.254.0 inet6 ...
1
vote
4answers
44 views

Two operations with sed on the same pattern

I use this following sed command for display names of files with a specific form: ls -1 *|sed 's/^\(.*\).png/\1\/\1,/g' If I have two files named BOH_Contour.png and BOV_Web.png, I obtain ...