sed is a command-line stream editor for filtering and transforming text.

learn more… | top users | synonyms

0
votes
2answers
277 views

Reordering strings in linux

How can I change lines around using the command line? e.g. I have these lines: Acct-Status-Type = Start User-Name = "37XXXXXXX" Event-Timestamp = "Apr 12 2013 15:56:55 AMT" I need to ...
1
vote
3answers
613 views

Newbie struggles with grep, sed, awk to filter html

I am a beginner linux user, trying to teach myself how to use linux tools on a cygwin install. I decided to make up a project to try to teach myself the basics of shell scripting and simultaneously ...
3
votes
3answers
3k views

Delete XML node containing certain element

I want to remove all Placemarks from a KML file that contain the element <tessellate>. The following block should be wholly removed: <Placemark> ...
0
votes
1answer
197 views

replacing text and deleting text using awk in file using

I have a script and I want to do some replace and delete operations on it. I used sed to extract values between words SendCommands and end like this sed -n '/SendCommands/,/end/p' ddtt As awk was ...
0
votes
2answers
60 views

How to delete lines where the given part of the line is more than 100 chars?

I know I can delete lines that are longer than 100 chars with this: sed '/^.\{100\}..*/d' But I have the following example line: <a ...
9
votes
2answers
5k views

Is there a way to detect null bytes (␀, NUL, \0) in sed?

Related to another question, in order to fuzzily detect binary files, is there a way to detect ␀ bytes in sed?
2
votes
2answers
371 views

add “#” in begining to selected lines in File

Requirement : ADD someting (i.e #) in begining of every line in file A which is grep from file B File A abcd abdc sdfg asdfa jon ram File B jon abcd grep file B from file A and add "#" ...
5
votes
1answer
10k views

Replacing string based on line number

I have a situation where i want to replace a particular string in many files Replace a string AAA with another string BBB but there are lot of strings starting with AAA or ending in AAA ,and i want ...
25
votes
9answers
7k views

Addition with 'sed'

I am trying to perform a mathematical operation with sed, but it continues to treat my variables as strings. The input is of this kind: $ echo 12 | sed 's/[0-9]*/&+3/' $ 12+3 I'd like to have ...
2
votes
1answer
882 views

exchange two words using sed

I am trying to exchange two words in a line but it doesn't work. For example: "Today is my first day of university" should be "my is Today first day of university" This is what I tried: sed ...
0
votes
3answers
119 views

Grep end regex matching

On OS X, system_profiler SPHardwareDataType outputs: Hardware Overview: Model Name: MacBook Pro Total Number of Cores: 4 L2 Cache (per Core): 256 KB L3 Cache: 8 MB Memory: 8 GB I want to ...
2
votes
1answer
87 views

Deciphering sed commands

I just run across the following sed command: sed "s|^/samba|\\|;s|/|\\|g" I have seen sed substitute commands before. I also know sed allows the usage of any character as a delimeter (| in this ...
1
vote
1answer
128 views

What does x option for sed do actually when exchanging data between hold and pattern buffer?

I dont understand what x does when it comes to exchanging the contents of hold and pattern buffer.Does it exchanges the data between hold and pattern so that any previous data in hold or pattern is ...
1
vote
2answers
282 views

Regex and piped commands with sed

I'm finding really hard to use sed command, plus I can't seem to find well written tutorials. Let me say that I worked with regular expression in other languages (Python, JavaScript, Java), so that ...
2
votes
2answers
2k views

Using sed to process passwd file

I am trying to learn sed, but I'm having a lot of trouble. What I am trying to do is process my passwd file using a bash script with sed commands to do the following: For every user with group ID ...
2
votes
3answers
343 views

awk, sed, grep, perl… which to print out in this case?

I have this syntax in a file (http response times from analog): <thead><tr><th class="x">seconds</th><th class="R">reqs</th><th ...
-1
votes
1answer
231 views

Replacing part of a string with another part of that same string [closed]

How would I go about replacing part of a string with another part of that same string, in a bash script, using sed?
2
votes
3answers
2k views

Bash commands/script to remove a line from CSV with duplicate in column

I have a lot CSV files that I have combined. However, there are duplicates, but the entire line is not duplicated. I do have a column that I want to use as the criteria to search for a duplicate. ...
3
votes
1answer
64 views

How to edit files in-place while performing operation on the values matching the searched pattern?

Given a list files containing random text and many datetimes in ISO format in it (e.g "2012-07-02T10:47:24+02:00"), how can I find all these datetimes and add 2 hours to each one ? Ideally a solution ...
6
votes
4answers
14k views

Text between two tags

I wanna retrieve whatever is between these two tags – <tr> </tr> – from an html doc. Now I don't have any specific html requirements that would warrant for an html parser. I just plain ...
3
votes
4answers
1k views

Replacing pattern after nth match is found on each line?

I have a file containing lines: india;austria;japan;chile china;US;nigeria;mexico;russia I want to replace all the occurences of semicolon on each line with e.g. ;NEW;, but starting from the 2nd ...
0
votes
1answer
52 views

How can I update this sed oneliner?

INPUT: $ echo -e 'AAAART5530408XXXX\nAAAAZE6530408XXXX\nAAAART12345678XXXX' AAAART5530408XXXX AAAAZE6530408XXXX AAAART12345678XXXX $ OUTPUT: $ echo -e ...
2
votes
3answers
1k views

Delete files if contents do not match pattern

There are hundreds of .html files in a directory. I need to delete files that don't contain word bluecar in their contents. I thought sed with rm would do that, but I don't know how to combine them.
1
vote
1answer
123 views

How to parse this output and put it into an array?

i have expect script whose output looks like : I would like to extract all words like Gi/02/12 etc in an array or a list. VLAN Name Status Ports ---- ...
1
vote
2answers
80 views

Match ids and print original file

I have two files Original: (5000 entries) Chr Position chr1 879108 chr1 881918 chr1 896874 … and a file with allele frequencies (2000 entries) Chr Position MAF chr1 881918 0.007 ...
2
votes
2answers
9k views

How can I replace text after a specific word using sed?

I have a file named .ignore. In need to replace the projdir. For example: ignore \..* ignore README projdir Snake I need to replace Snake with, for example, "PacMan". I read the man page, but I ...
4
votes
2answers
7k views

Sed: Replace N first occurrences of a character

I am looking to replace the 5 first occurences of the whitespace character per line inside a sed script. Here's what I have so far sed -e "s/ /;/" -e "s/ /;/" -e "s/ /;/" -e "s/ /;/" -e "s/ /;/" ...
-1
votes
2answers
5k views

Bash -Extract characters from string

Suppose I have the following variable $string = 'cat somecommandhere' Now the output of the above cat command is test="Thanks serverfault" I want to extract the value between the quotes and ...
0
votes
2answers
215 views

sed extract with multiple options in end pattern

I get some output from a command, I have to extract text between two patterns from the output. Start pattern is fixed. But the end format can be one of two (lets say word2-1 and word2-2). Is there ...
2
votes
1answer
68 views

extracting and copying parts of tex files into new tex files

I have a bunch of tex files in different folders on my system. The goal is to create new tex files (using a template, that has the title page, packages, new commands,...) that combines all the ...
2
votes
2answers
443 views

changing pattern by removing spaces?

file : hi hello,new york, , ,brazil site ,brazil january,month is feb , , ,indiana jones task: delete all horizontal space (spaces and tab) between any two comas (like , ,) if ...
2
votes
1answer
158 views

how do i suppress seds unnessary output while using option -e?

why n option is not working here [root@testgfs2 final]# echo a b c | sed -ne 's/[[:blank:]]/"/gp' -ne 's/^/"/pg' -ne 's/$/"/pg' a"b"c "a"b"c "a"b"c" i just need : "a"b"c" actually ...
6
votes
3answers
1k views

Multi-line replace

I spent ages trying to figure this out. As it happens, I don't need to do it any more; I found another way. But for the sake of my sanity, I'd like to know the answer anyway. It's quite easy to use ...
3
votes
2answers
6k views

Strip trailing whitespace from files

The answer to removing trailing whitespace with sed has most of the answer, but I want sed -i 's/[ \t]*$//' $1 to be able to take arbitrary number of file arguments as a shell script on the command ...
1
vote
4answers
88 views

How to find what device a file is on (and use that in a script)?

I want to find out what device my file is on so that I can use it in a script. I can get this far: $ df . Filesystem 512-blocks Used Available Capacity Mounted on /dev/disk0s2 498438976 ...
2
votes
4answers
115 views

How do I correct both too many and too few space characters?

I have files that are edited by people other than me. They contain lines that look like this: <E> This is text </E> I use some Bash shell scripts do a bunch of text replacement ...
1
vote
1answer
221 views

Why is it that , to newline is working but newline to , is not working sed?

I have got a text file with a list of first names, and I am trying to replace newline with ,. Here is the command I am using sed 's/\ /,/g' file while the reverse is working sed 's/,/\ /g' file ...
1
vote
2answers
150 views

sed pattern matching with deletion over a line

I want to delete only some spaces(say 4) after the line$#*425 with space I am not able to complete it please suggest echo "line$#*425 with space " | sed 's/ /\1 \2/g' i am thinking of ...
1
vote
2answers
764 views

Print fields from file only if line starts with a specific word

I have the following file: … LINK=dummy 172.17.100 => 10.218.11 [PATH=/etc] FILE=hosts 172.17.100 => 10.218.11 [PATH=/etc] FILE=network 172.17.100 => 10.218.11 ...
0
votes
2answers
431 views

remove a char string from a command output (sed, or maybe something else)

I'm trying to retrieve the distro name from the lsb_release -i output, but using lsb_release -i | sed 's/Distributor ID: //g' won't do the trick. What am I doing wrong? Or maybe should I change ...
1
vote
1answer
2k views

How to calculate average requests per seconds using awk or sed on Apache logs

I am trying to calculate the average requests per seconds for a specific period of time of my Apache logs. I have been able to narrow the results down to the period I am interested in, as well as ...
0
votes
1answer
133 views

Having problem using sed | Trying to replace a line

Contents of gaurav.txt file $generalNetPath = "/net"; $generalNetPath = "/glbusers4/glb/aimsys/apxwrk48"; I trying to replace /glbusers4/glb/aimsys/apxwrk48 by pwd as follows qaz=`pwd` sed ...
8
votes
4answers
2k views

How do I write a sed one-liner to add a character after every third character?

So, I have a string that looks like this: AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA And I want to split the string into 3-character chunks delimited by a '+' sign. ...
1
vote
1answer
112 views

using sed for replacing strings with “/”

need to replace < network> with a "192.168.61.0/24" but i am not able to do it with sed, tried sed -i s/"< network>"/"192.168.61.0/24"/g file.sh but this is not working,can some one ...
1
vote
1answer
75 views

sed into csv format

I have a file of the form VL-8299673,30.000,49.000,1.000,21.901,2630.000,428861.000 VL-8299673,1071.000,570.000,35.000,3963.608,632.000,366563.000 ...
1
vote
2answers
114 views

How can fill characters in sed only

I have this file. I want to use only sed, no awk FSDFDSFSD FDSFD FHGDHFDHGHFGHGHGF HHGDF GFDGDFGFDG GFDGFDGFDGDFGDGD I want to fill every odd line appended with 000 so that total characters are 30 ...
4
votes
2answers
313 views

Why does this add spaces? echo “x ax” | sed 's/x\s*/x /'

I want to find a x, and replace the 0 or more following spaces (\s*) with just a single space. echo "x ax" | sed 's/x\s*/x /' For some reason, instead of replacing the spaces with the single space, ...
2
votes
3answers
549 views

Use find + sed + cp to find files and copy them to a directory with a different name

I'm trying to copy a bunch of files named folder.jpg into a folder. The problem is because all the files are named the same thing, I need to rename them in the process. I know I can probably do it ...
5
votes
3answers
1k views

How to remove all white spaces just between brackets [] using bash? [duplicate]

Replace text between brackets Input testing on Linux [Remove white space] testing on Linux Output testing on Linux [Removewhitespace] testing on Linux So, how can we just remove all the ...
9
votes
4answers
5k views

Efficient in-place header removing for large files using sed?

The commands below may takes minutes depends on the file size. Is there any more effient method? sed -i 1d large_file