Sed is a command-line stream editor for filtering and transforming text.

learn more… | top users | synonyms

0
votes
2answers
537 views

How do i remove all occurences of semicolon from the end of all lines?

These are the steps i am following. `sed 's/[;]+$//g'` also sed 's/;{1,\}$//g'
1
vote
2answers
75 views

Match ids and print original file

I have two files Original: (5000 entries) Chr Position chr1 879108 chr1 881918 chr1 896874 … and a file with allele frequencies (2000 entries) Chr Position MAF chr1 881918 0.007 ...
-2
votes
1answer
256 views

Search low values in mainframe files

I am working with mainframe files and it seems that the low values (x'00') exists in the records in the file which throws off my import for fixed block. Does anyone know how to eliminate those ...
2
votes
2answers
5k views

How can I replace text after a specific word using sed?

I have a file named .ignore. In need to replace the projdir. For example: ignore \..* ignore README projdir Snake I need to replace Snake with, for example, "PacMan". I read the man page, but I ...
0
votes
2answers
151 views

sed extract with multiple options in end pattern

I get some output from a command, I have to extract text between two patterns from the output. Start pattern is fixed. But the end format can be one of two (lets say word2-1 and word2-2). Is there ...
3
votes
6answers
844 views

Is there a faster way to remove a line (given a line number) from a file?

A related question is here. I often have to edit a large file by removing a few lines from the middle of it. I know which lines I wish to remove and I typically do the following: sed ...
-1
votes
2answers
3k views

Bash -Extract characters from string

Suppose I have the following variable $string = 'cat somecommandhere' Now the output of the above cat command is test="Thanks serverfault" I want to extract the value between the quotes and ...
2
votes
1answer
67 views

extracting and copying parts of tex files into new tex files

I have a bunch of tex files in different folders on my system. The goal is to create new tex files (using a template, that has the title page, packages, new commands,...) that combines all the ...
2
votes
1answer
74 views

how do i suppress seds unnessary output while using option -e?

why n option is not working here [root@testgfs2 final]# echo a b c | sed -ne 's/[[:blank:]]/"/gp' -ne 's/^/"/pg' -ne 's/$/"/pg' a"b"c "a"b"c "a"b"c" i just need : "a"b"c" actually ...
2
votes
2answers
216 views

changing pattern by removing spaces?

file : hi hello,new york, , ,brazil site ,brazil january,month is feb , , ,indiana jones task: delete all horizontal space (spaces and tab) between any two comas (like , ,) if ...
4
votes
3answers
689 views

Multi-line replace

I spent ages trying to figure this out. As it happens, I don't need to do it any more; I found another way. But for the sake of my sanity, I'd like to know the answer anyway. It's quite easy to use ...
0
votes
3answers
194 views

For all files that does not contain a string, prepend a string to the file

I am trying to iterate through a list of html files, check to see if {% load static from staticfiles %} exists in the file and if it does not exists, prepend {% load static from staticfiles %} to it. ...
1
vote
2answers
367 views

reading from a file and changing its pattern into an array?

I have a CSV file containging entries like this : ipaddress,VLAN,VLANid 10.192.168.1,vlan-xyz,3 10.192.168.1,vlan-abc,8 10.192.168.1,vlan-mnp,11 10.192.163.24,vlan-llz,3 10.192.163.24,vlan-bbz,5 ...
1
vote
4answers
81 views

How to find what device a file is on (and use that in a script)?

I want to find out what device my file is on so that I can use it in a script. I can get this far: $ df . Filesystem 512-blocks Used Available Capacity Mounted on /dev/disk0s2 498438976 ...
2
votes
4answers
110 views

How do I correct both too many and too few space characters?

I have files that are edited by people other than me. They contain lines that look like this: <E> This is text </E> I use some Bash shell scripts do a bunch of text replacement ...
1
vote
2answers
137 views

sed pattern matching with deletion over a line

I want to delete only some spaces(say 4) after the line$#*425 with space I am not able to complete it please suggest echo "line$#*425 with space " | sed 's/ /\1 \2/g' i am thinking of ...
1
vote
2answers
352 views

Print fields from file only if line starts with a specific word

I have the following file: … LINK=dummy 172.17.100 => 10.218.11 [PATH=/etc] FILE=hosts 172.17.100 => 10.218.11 [PATH=/etc] FILE=network 172.17.100 => 10.218.11 ...
0
votes
2answers
246 views

remove a char string from a command output (sed, or maybe something else)

I'm trying to retrieve the distro name from the lsb_release -i output, but using lsb_release -i | sed 's/Distributor ID: //g' won't do the trick. What am I doing wrong? Or maybe should I change ...
1
vote
1answer
1k views

How to calculate average requests per seconds using awk or sed on Apache logs

I am trying to calculate the average requests per seconds for a specific period of time of my Apache logs. I have been able to narrow the results down to the period I am interested in, as well as ...
3
votes
2answers
497 views

Split log file by time range

I have a log file and would like to cut it into copies of 15min. In the log file the lines start with: dd mmm yyyy hh:mm:ss,xxx e.g. 12 Feb 2013 16:05:02,xxx log text... and the file rotates ...
5
votes
4answers
7k views

Text between two tags

I wanna retrieve whatever is between these two tags – <tr> </tr> – from an html doc. Now I don't have any specific html requirements that would warrant for an html parser. I just plain ...
5
votes
1answer
3k views

How to replace a left parenthesis with sed?

I have to replace ( with some character in my file, and I can't do it. \( is used for grouping in sed and when I used \\( with sed, it treated it as \( character not as just (. It seems like a tricky ...
1
vote
1answer
92 views

using sed for replacing strings with “/”

need to replace < network> with a "192.168.61.0/24" but i am not able to do it with sed, tried sed -i s/"< network>"/"192.168.61.0/24"/g file.sh but this is not working,can some one ...
1
vote
1answer
74 views

sed into csv format

I have a file of the form VL-8299673,30.000,49.000,1.000,21.901,2630.000,428861.000 VL-8299673,1071.000,570.000,35.000,3963.608,632.000,366563.000 ...
1
vote
2answers
102 views

How can fill characters in sed only

I have this file. I want to use only sed, no awk FSDFDSFSD FDSFD FHGDHFDHGHFGHGHGF HHGDF GFDGDFGFDG GFDGFDGFDGDFGDGD I want to fill every odd line appended with 000 so that total characters are 30 ...
4
votes
2answers
277 views

Why does this add spaces? echo “x ax” | sed 's/x\s*/x /'

I want to find a x, and replace the 0 or more following spaces (\s*) with just a single space. echo "x ax" | sed 's/x\s*/x /' For some reason, instead of replacing the spaces with the single space, ...
1
vote
1answer
169 views

Why is it that , to newline is working but newline to , is not working sed?

I have got a text file with a list of first names, and I am trying to replace newline with ,. Here is the command I am using sed 's/\ /,/g' file while the reverse is working sed 's/,/\ /g' file ...
2
votes
3answers
357 views

Use find + sed + cp to find files and copy them to a directory with a different name

I'm trying to copy a bunch of files named folder.jpg into a folder. The problem is because all the files are named the same thing, I need to rename them in the process. I know I can probably do it ...
4
votes
2answers
410 views

Out of memory while using sed with multiline expressions on giant file

I am currently trying to remove all newlines that are not preceded by a closing parenthesis, so I came up with this expression: sed -r -i -e ":a;N;$!ba;s/([^\)])\n/\1/g;d" reallyBigFile.log It does ...
4
votes
3answers
772 views

How to remove all white spaces just between brackets [] using bash? [duplicate]

Replace text between brackets Input testing on Linux [Remove white space] testing on Linux Output testing on Linux [Removewhitespace] testing on Linux So, how can we just remove all the ...
3
votes
2answers
285 views

sort a file based on length of the column/row

I need to sort a file based on the number of chars in the first column. I have no idea on how to go about this. (On Linux, so sed/awk/sort is available). An example: .abs is bla bla 12 .abc is bla ...
2
votes
2answers
253 views

sed: replacing newline at a given line (or last line)

I have a file like the following: a,b,c,d,e,f 1,2,3,4,5,6 7,8,9,0,1,2 I need to join the last two lines with a comma, like so: a,b,c,d,e,f 1,2,3,4,5,6,7,8,9,0,1,2 The problem is that this is all ...
3
votes
2answers
115 views

How to convert *text* to {\i text} with sed?

I would like to replace every occurrence of *text* into {\i text}. text *text* text *text* text *text* *text text text* text should become text {\i text} text {\i text} text {\i text} {\i text ...
1
vote
2answers
1k views

Help inserting a new line of text after matching a line of text (sed)?

I need to insert a hidden HTML input tag into any form tag within a bunch of HTML files. I assume this is possible with sed, but need help forming the command. My idea is to search for any instance ...
0
votes
3answers
145 views

How to delete number of lines from file repetitively

I've read How do I delete the first n lines of an ascii file using shell commands?, it is helpful. However I've a file something as below (please consider 2 columns as 2 different files): 1 4 1 4 1 4 ...
1
vote
1answer
184 views

sed edit text block: not greedy match

I wish I can grab the first html comment in a file using sed. Using '/<!--/,/-->/ and having more than one comment block it will match all the content between the first and the last comment ...
3
votes
5answers
941 views

Remove lines based on pattern by keeping first n lines

I need to remove lines from a text file based on pattern but I need to keep the first n lines of that pattern. Input % 1 % 2 % 3 % 4 % 5 text1 text2 text3 output %1 %2 text1 text2 text3 I used ...
1
vote
3answers
78 views

sed replace - need help replacing text in bunch of files

How to parse bunch of files and replace each occurance of __esct function? __esct('Full name') convert to: $this->escape($this->translate('Full name')) I'm confused as to - how ...
2
votes
2answers
114 views

Extract code excerts from markdown file

I have a pandoc markdown file which has a lot of code. I want to extract all the code bits from file preferably using sed. The syntax of code in pandoc is three or more ` signs to start and finish the ...
4
votes
4answers
6k views

removing the first and the last character of every line from command line

I am trying to remove the first and the last characters of everyline in a text file and save the resulting truncated version in a new file. Does anyone have an idea about how to do that efficiently ...
0
votes
2answers
1k views

Replace matches with multiline string using sed [duplicate]

Possible Duplicate: Insert a multiline string into another string I have a file called foo.txt containing: foo bar baz I want to replace every occurence of bar with a multiline string, ...
1
vote
3answers
512 views

linux/solaris + verify duplicate valid IP address from file

what the best way to find duplicate IP from file ( I have ksh script in this script I need to write function that check for duplicate IP ) for example if IP - 192.1926.23.52 exists twice in file - ...
4
votes
2answers
1k views

sed: multi-line replace of config block

I have some configuration files that basically look like (...content...) # BEGIN DYNAMIC BLOCK - DO NOT EDIT MANUALLY (... more content ...) # END DYNAMIC BLOCK (... even more content ...) Now, in ...
3
votes
5answers
385 views

Print non-existent files from a pipe input

I have a directory of lots of .PDF and .JPG files. There should be a .JPG file for each .PDF with the same name. I'm trying to use a command to find .PDF files that doesn't have a .JPG file. My ...
8
votes
4answers
915 views

How do I write a sed one-liner to add a character after every third character?

So, I have a string that looks like this: AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA And I want to split the string into 3-character chunks delimited by a '+' sign. ...
1
vote
1answer
187 views

Sed and Awk learning material [closed]

I'm looking for some learning material for sed and awk, can anyone make any suggestions? Please don’t refer to man and help pages. -O-
1
vote
1answer
118 views

how to add a description in footer

I enjoy learning how to modify files with awk, sed, and bash. However, I know it could cause issues down the road and I would like to be prepared with a log inside the file. I was thinking about how ...
2
votes
5answers
437 views

Replacing lines in files with file contents

I have several files which contain some PHP includes and I want to substitute them with the file contents. The file looks like foo <?php include("file1.php"); ?> bar baz <?php ...
0
votes
1answer
278 views

globbing, sed, or awk html files

I wanted to create a script that I could check .xhtml files for images and add alt tags if needed. While searching I found regular expressions and did man on glob but I'm unsure on where or what to ...
2
votes
2answers
1k views

extract last match from logfile till end

Using sed, grep, awk, or ruby, what's a simple way to find the last match of a string in a larger log file, and send every line following it (inclusive) to another file? Example: grep -A222 ...