sed is a command-line stream editor for filtering and transforming text.

learn more… | top users | synonyms

-1
votes
1answer
18 views

How to convert Log file to CSV using bash

Is it possible to turn this log entry into a properly formatted csv file using sed/awk? I've tried multiple ways to do this using sed/awk. Alas I couldn't do it. Before I do it in perl. is this ...
1
vote
3answers
34 views

Removing mulitple lines

I am trying to write up a command line interfaces that will removes a particular section / lines of codes within a list of json files. By the way, the json file are located within the sub-folders of ...
2
votes
3answers
52 views

Replace multiline string in files

I have a number of files I want to update by replacing one multi-line string with another multi-line string. Something along the lines of: * Some text, * something else * another thing And I want ...
2
votes
4answers
50 views

Removing an empty line and the line above it

I have a large .fna file containing millions of DNA sequences. Due to some write errors after truncating my primers, I'm left with some sequence headers with no sequence following it. An example is ...
3
votes
3answers
137 views

sed fails to remove newline character

I've been using sed for quite some time but here is a quirk I came around with, which I am not able to resolve. Let me explain my problem with the actual case. Scene#1 printf "ls" | xclip ...
4
votes
2answers
102 views

sed “e” and “g” flags not working together

Given this: echo AAA | sed -r 's/A/echo B/ge' I get this: Becho Becho B I would have thought I would get "BBB". This is with GNU sed version 4.2.1. What is going on, and how can I use the ...
4
votes
3answers
41 views

How to select first occurrence between two patterns including them

How can I select first occurrence between two patterns including them. Preferably using sed or awk. I have: text something P1 something content1 content2 something P2 something text something P1 ...
0
votes
0answers
13 views

Escape ampersand in bash variable used as a sed argument [duplicate]

I have a template Hello NAME welcome and want to replace NAME with data like "Judy&Mary". Why does this not work? TEMPLATE="Hello NAME welcome" DATA="Judy&Mary" echo $TEMPLATE | sed -e ...
0
votes
3answers
51 views

how to replace a character within in a multiple double quoted words within a line using sed?

I have text file including text format like this. 012345,"[ThinkPadT2/3Gband,Mac]",Lenovo,"iPhone3G,A1241" How do i replace comma inside words only within double quote by pipe(|) operator using ...
1
vote
1answer
36 views

How can I use regex to extract the text following two conditions into a variable?

I'd like to extract a setting for a given host in the ssh_config file and put it into a variable. Host mysite HostName 123.1.1.1 User myuser Port 13245 GSSAPIAuthentication no ...
1
vote
2answers
46 views

Formatting ifconfig using sed/awk

I'm using ifconfig on OpenSUSE. When I run ifconfig eth0 I get eth0 Link encap:Ethernet HWaddr CE:FD:75:DF:A5:6D inet addr:172.16.4.177 Bcast:172.16.5.255 Mask:255.255.254.0 inet6 ...
2
votes
3answers
89 views

How can I insert the contents of a file into a string in bash

I would like to append the contents of a multi-line text file after a particular line in a string. For example, if the file file.txt contains line 1 line 2 I'd like do so something like printf ...
1
vote
4answers
41 views

Two operations with sed on the same pattern

I use this following sed command for display names of files with a specific form: ls -1 *|sed 's/^\(.*\).png/\1\/\1,/g' If I have two files named BOH_Contour.png and BOV_Web.png, I obtain ...
0
votes
2answers
32 views

Replace some text with sed

I have tried this to replace the resis_test by m.gds by searching the key word LAYOUT_PRIMARY. sed -e 's/\(LAYOUT PRIMARY\).*\1 /m.gds/' < FILE.ex > b FILE.ex LAYOUT PRIMARY "resis_test" ...
2
votes
2answers
184 views

How to remove all CRLF in file (not replace with LF)

I'd like to remove all carriage returns followed by line feeds (CRLF), such as \r\n in a file. How can I do that? I can't use dos2unix because that replaces CRLF with LF. And I can't use tr because ...
1
vote
0answers
40 views

sed stdin behaviour

Using sed for a direct stdin treatment of data, I expect that a line is treated after the enter. This is what happens when I test on CygWin or Linux but on my AIX, a second new line is needed to treat ...
1
vote
2answers
38 views

Get current timezone on Centos 7

On previous version of centos , i used the following command to get the current timezone in my bash script timezone=$(sed 's/ZONE=//g' /etc/sysconfig/clock) Output is "America/New_York" How can i ...
1
vote
5answers
58 views

Using sed to cut a string starting with n spaces and ending with n spaces

How to use sed to cut text starting with x spaces and ending with y spaces? For instance This is my string: kkk 111 fff aaabbb 5d98 ccc mmmppp 9369d and I want to get this output: ...
3
votes
3answers
125 views

Strip off word pattern at the end of string using sed

I have following string: ksh -x SCRIPT2.ksh $BUSSINESSDATE & PID=$!; ksh -x SCRIPT1.ksh $BUSSINESSDATE & PID=$!; I want to strip off the last word & PID=$!;. Desired result is: ksh -x ...
2
votes
2answers
53 views

Search and Replace question

I need to find all occurrences of AAsomeArbitraryStringBB and replace it with CCsomeArbitraryStringDD. So AAHelloBB Text AAByeByeBB becomes CCHelloDD Text CCByeByeDD. It's important to note ...
2
votes
2answers
75 views

Extracting values from a file keyed by multiple keys

Consider a file with key=value pairs, and each key is optionally a concatenation of multiple keys. In other words, many keys can map to one value. The reason behind this is that each key is a ...
1
vote
3answers
59 views

Pattern Search between specific lines and print line numbers

I have a file of 20 lines. I want to search for a string between the lines 10 and 15 and print the string along with the line numbers of the original file. I have tried sed -n 10,15p file | grep -n ...
3
votes
1answer
38 views

Filter out inconsistent data blocks

I would like to filter out rows that has inconsistent geno values in line-part blocks. In case of duplicate consistent values , I would just keep the first row. As example, 'gf345 part1' has more ...
2
votes
4answers
54 views

Rename mp3 file names to a pattern

I have a list of like names likes so: /A/B/C/D/E/F/filename_album1-003.mp3 its more like album\d+ I would like to change it to something like /A/B/C/D/E/F/filename_song-3.mp3 song is just a ...
1
vote
2answers
46 views

find and replace a value in a line of text

I have a text file which contain only 1 line of text 1314:Battery:1.90:50:30 I'm trying to figure out if is there anyway to do a grep and sed to change the value 50 and 30 to the following ...
0
votes
1answer
28 views

Prepending text read from a file on the top of another file [duplicate]

I want to add "void mainfunction()" on the top of a file. I am reading the actual name of the file from another file and the name of the main function from another file. I was using sed -i '1i void ...
3
votes
3answers
49 views

extract from line to line and then save to separate file

I tried my luck with grep and sed but somehow I don't manage to get it right. I have a log file which is about 8 GB in size. I need to analyze a 15 minute time period of suspicious activity. I ...
0
votes
1answer
39 views

How can I replace string in a file?

I have the following line in a file, I would like to insert \N between two comma 20121128020001,2012-11-28 02:00:01.000,,,,,,,3.80,,,,, I tried to use seed sed -i 's/,,/,\\N,/g' Test.CSV Where I ...
2
votes
1answer
45 views

How to use variables in sed command

I'm trying to run sed -i "/$variable/c \$variable1' file.txt But it's not displaying any change in the file: file.txt. But the same command, with out the variables works fine: sed -i "/variable/c ...
3
votes
3answers
206 views

Need to insert single quotes in text file for use as SQL query using sed

I have created a line of text that looks like this: INSERT INTO radcheck(id, username, attribute, op, value) VALUES (,,00:23:32:c2:a9:e8,Auth-Type,:=,Accept); I want to use sed to make it look like ...
3
votes
4answers
153 views

pattern match and capturing in unix

I have a file like this: A1-1915435_1_MIMAT0000069_MirBase_miR-16_microRNA_1_22-A1-1915435_1_ENSG00000206737_ENST00000384010_U1_snRNA_73_115 ...
3
votes
3answers
106 views

Extract lines between and including 2 patterns

I have a file with data structured as follows 1, p1, p2, p3, p4, p5, p6, p7 2, p9, p10,, 2, q1, q2, q3, q4, q5, q6, q7 2, q9, q10,, 2, r1, r2, r3, r4, r5, r6, r7 2, r9, r10,, 1, s1, s2, s3, s4, s5, ...
2
votes
2answers
92 views

How to avoid that an insertion pattern using sed is applied to the middle of a string?

Aim The aim is to convert the following string: hello_hello,123-world567-helloworld123456,world1234-hello09876 using sed into a specific format. Attempts sed -e ...
1
vote
2answers
52 views

Remove a line if regex exists only in 1st column of each line in a csv file

I have the following comma-delimited data (spaces used for visual clarity): 1 2014 23 2352 19.24 7.18 1 2014 23 2353 19.78 4.65 24 2014 23 2354 20.26 25.34 1 2014 23 2355 26.65 42.76 1 2014 23 ...
4
votes
5answers
135 views

how to split file and lines

I have a text file like : 1_01 { ; quite good spirals reset=2000 type=mandel passes=1 corners=-0.6014129278/-0.5990935452/0.427747516/0.429487053 params=0/0 float=y ...
3
votes
4answers
119 views

How to swap entire html blocks in multiple files with sed

I have tons of html pages with a simlar content as follows: <div class="wrapper"> <div class="aaa"> ...lot of html1 here like div's/spans etc.. </div> <!-- end aaa --> ...
5
votes
5answers
260 views

How to run a command only if sed replace strings

I want to enable multiverse repository in Ubuntu by a command line. sed -i "/^# deb.*multiverse/ s/^# //" /etc/apt/sources.list && apt-get update This command will run apt-get update every ...
5
votes
4answers
339 views

Remove next-to-last extension in a file name

Suppose a folder with many files with bad extensions,for example Song1.avi.mp3 Song2.avi.mp3 Song32.web.mp3 Song23.mp4.mp3 Song2a.mp9.mp3 I want to remove only the second field (web, avi, mp4). I ...
4
votes
2answers
166 views

Replace or append a line with string within a file

I am looking for advice on how to search a part of a string within a file and replace the complete line OR append that string to that file if not found. I "played" with sed for a while now, but ...
0
votes
2answers
106 views

how to rename multiple files by replacing string in file name? this string contains a “#”

How to replace a text string in multiple files in Linux How to rename multiple files by replacing word in file name? Replace string in files with certain file extension Searching a number of files ...
4
votes
3answers
98 views

Using sed to search for a string and print everything before and after within a range

I have this file: sometext1{ string1 } sometext2{ string2 string3 } sometext3{ string4 string5 string6 } I want to search this file for a specific string and print everything before this string ...
5
votes
4answers
118 views

Increment numeric pattern in file

I have a File that contains only the following line: BOF (REF-REQ0001 SW_requirement) EOF I need to generate a second file that would contain the following: BOF (REF-REQ0001 SW_requirement) ...
4
votes
4answers
99 views

Remove a character between 2 known strings

I have a data set like below: \"XXX \ START sapiodj \\" aj \d 2387 END hddo\" START bbcc \\" END ss My Requirement: I want to remove all occurrences of backslash\ and double quotes " between ...
1
vote
0answers
18 views

Take the unknown contents of variable as literal in sed [duplicate]

I have two files: a.patterns contains patterns in a one per line way "`" "^" "<" "<(" "<)" "<[" "=" ">" "_;|^+*+?@" and b.data contains comma separated values. 1,1,0,"*",1 ...
3
votes
4answers
138 views

tab separation of the file

I have a file with seq likes this ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT ...
5
votes
3answers
125 views

Replace uppercase to lowercase except first letter of each word in specific line

I want to replace names that I received in uppercase letters only. The names are mixed with other information which should stay as it is. AUTH: at the beginning of the line identifies it as a line ...
6
votes
3answers
210 views

sed with multiple expression for in-place arguement

I am trying to replace multiple words in file by using sed -i #expression1 #expression2 file Something 123 item1 Something 456 item2 Something 768 item3 Something 353 item4 Output (Desired) ...
0
votes
2answers
59 views

Extract multiple instances of text between two strings [closed]

I'd like to extract text between two strings in a text file that contains Spotify chart results Text file extract: ...
0
votes
1answer
60 views

Need to swap the -(minus) sign for only numbers and not text for a given row

I have a input in which delimeter is <;| like given below:- 1-<;|3-Text <;|3.13-<;|0.28-<;|9 0.12-<;|2-Text <;|3.99-<;|4.11-<;|6 0.13-<;|3-Text ...
3
votes
1answer
67 views

sed repeating the last line in the stream

I have code in a script similar to this... smbconffile="/etc/samba/smb.conf" sed -i 's/.*[\[CMI\]]/\[CMI\$\]/' $smbconffile && echo "Success" || "Failed" sed -i 's/.*[\[LOCAL\]]/\[LOCAL\$\]/' ...