The tag has no wiki summary.

learn more… | top users | synonyms

4
votes
2answers
66 views

Replace very long string in files recursively

I have a very long and complex string in many files and I want to remove/replace it recursively. The string contains many slashes, backslashes and spaces and any kind of special signs. How do I do ...
1
vote
2answers
32 views

search and replace string

I have a XML tag for example <tag name="abc"></tag> I wanted to replace the string inside "" with the tag name i.e the upper XML tag should be become now <abc ...
0
votes
2answers
56 views

How to count number of instance of a word starting at another word

I need to grep the MySQL-error log starting at today's date formatted like: `date +"%y%m%d"` (140710) And look for all instances of the word partitioned. I've tried various things to no avail. ...
3
votes
2answers
81 views

Find and replace different columns using awk

I try to make a change in a file: Find a certain value and substitute it with another value in a different column using awk. Input (UiO-66Zr-EH.mof): unit ntype qqatom 1 'Zr1' 0.0d0 vibration ...
0
votes
1answer
44 views

How to copy contents of command line search result in unix to a file?

I would like to accomplish the following. Copy the contents of all search results into a single file. I don't want to copy the search result but the file contents of the search result. For example ...
2
votes
3answers
49 views

searching multiple strings in multiple files inside a directory and printing the string and corresponding file name where it was found

I have around 500 strings and I want to search for the files which contain them inside a directory and get the file names which contain the strings. So far I've been using: find -name 'LYFNRE.*' ...
11
votes
3answers
279 views

Search for man pages which contain ALL of the words 'foo' 'bar' and 'baz'

I'd like to search for man pages which contain ALL of the words 'foo', 'bar' and 'baz'. If possible, I'd like to search through all text (not just name & description) of all man pages. I'm ...
2
votes
1answer
32 views

updatedb for a beginner

The updatedb command, as I understand it, is basically the utility that keeps the mlocate.db database file updated. And it's a good idea to keep it updated regularly. For that matter, I've kept a ...
1
vote
1answer
17 views

Can't search for flags in qalter's man page?

I was trying to find out what qalter's -r flag does, but I can't search for -r when viewing the man page for it (pattern not found). Yet it's clearly there. If you scroll down a bit you'll see it. Why ...
1
vote
1answer
22 views

Exiting a '&pattern' search in less

After using a search in less of the format &pattern, which displays only matching lines, how can I go back to displaying all lines in the file? Esc doesn't do anything as far as I can tell. ^C ...
14
votes
1answer
306 views

Is there a way to search manpages for typical use scenario?

I have a relatively small brain, so there is a limit to what I can store up there. I have been using Linux semi-pro-amateur for a few years and still I am amazed at how little commands I know. Simple ...
0
votes
4answers
157 views

Search for a Value only in one column w.o using awk, sed, or perl

I have a file that looks like this : Marketing Ranjit Singh FULLEagles Dean Johnson Marketing Ken Whillans FULLEagles Karen Thompson Sales Peter RobertsonPARTGolden ...
4
votes
1answer
55 views

Highlighting text in bash when using reverse history search using Ctrl-R

Using Ctrl-R, I can search the history in bash. But what to do, If I want to highlight the relevant word which has been typed upon by me. Example: (reverse-i-search)`mount': sudo mount /dev/sda2 ...
1
vote
7answers
717 views

Can grep be used for searching files with some string in their names?

I understand that grep can only be used for searching for files which contain a string in their content. Can it be used for searching for files with a string in their names? I read the manpage, and ...
1
vote
1answer
121 views

'ipkg search xxx' always returns no answer

On a Synology NAS (uses a 'home grown' *nix variant (possibly based on Debian?)) I have installed ipkg package manager. When I try a command like ipkg search shred or ipkg search *shred* it ...
2
votes
2answers
169 views

How to search and replace strings matching a replacement list for multiple files

I have a file, say map.txt, containing a list of search strings and corresponding replacements: search -> replacement bigBone -> bb fishMarket -> fm dogCollar -> dc ... I need to ...
7
votes
3answers
90 views

Can I force `man` to do lower case sensitive matching?

When I search man pages, the search is case sensitive, but only with regard to upper case letters. E.g., x will match x and X whereas X only matches x. This is the man-db version of man, used on ...
0
votes
1answer
54 views

Highlight patterns in command output (grep-like but without excluding lines) [duplicate]

I need a command that colorizes some symbol sequence in output of a certain command. I'd like it like grep make it. $ some-command | grep symbol-sequence However grep removed lines that isn't ...
2
votes
1answer
165 views

Find font file from font name on Linux

I have a font with the name Media Gothic. How can I find the file name of that font in Linux? I need to copy that file to another system. I've tried: find /usr/share/fonts/ -name '*media*' But this ...
1
vote
1answer
76 views

How to copy access.log lines by time?

I have a huge webserver access.log in CentOS. I access it over remote VPN so I cant copy the file or read it directly. I know the specific time in the logs I want to copy, but it is too far back too ...
1
vote
1answer
137 views

Can we make grep faster by indexing words in files? [duplicate]

Over a decade ago I imagined an improved version of grep that would use indexes to make recursive searching faster. I never got around to writing it, but I wonder if somebody else did! My original ...
2
votes
4answers
1k views

Compare two text files and find matching lines

I have two files A and B. A looks like this (4 to 6 lines): GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT ...
2
votes
2answers
30 views

Search for files by content only in trunk subdirectories

I think its a simple question, but the answer is probably a little more complicated :P Edit: Actually, its not complicated at all!^^ So I have a directory with multiple svn projects and I would like ...
0
votes
1answer
70 views

Lynx incremental search

I am trying to run an incremental search using lynx. Imagine a page, for example, an index_of page which contains several folders which also contain other subfolders and files. I want to run lynx in ...
3
votes
1answer
80 views

What does the search flag 'z' do in VIM?

I was looking for a way to show a bit of context around my searches when doing g/mysearchtext/p When I stumbled across this page Search-a-pattern-and-provide-a-context-few-lines-above-and-below ...
8
votes
2answers
316 views

Is there a command reverse search in vim?

In linux cli I can do ctrl-r and do a reverse search and choose something I have done easily. Is there something similar in vim? I mean I may run a command using : (could be anything like a long ...
18
votes
3answers
1k views

Unix command to check if any two lines in a file are same?

Is there a unix command that can check if any two lines in a file are the same? For e.g. Consider a file sentences.txt This is sentence X This is sentence Y This is sentence Z This is sentence X ...
9
votes
4answers
5k views

How can I “grep” patterns across multiple lines?

It seems I am misusing grep/egrep. I was trying to search for strings in multiple line and could not find a match while I know that what I'm looking for should match. Originally I thought that my ...
1
vote
2answers
64 views

Searching for packages using apt-get

I'd like to search for repository packages using package name or package description. For example Search for Zend Search for Ze*d
1
vote
2answers
71 views

Mailing out a customised content based on specific search in a logfile

Using below test.sh, I am getting result in dump.txt as below: test.sh: #!/bin/bash #"Maxl-script" zone starts..... essmsh -l admin password -s localhost -i << EOF spool on to 'dump.txt'; ...
1
vote
2answers
47 views

How to search for available software in repositories though CLI?

I want to be able to search all available software like one would using "Synaptic Package manager" or "Ubuntu Software Center" through Command Line.` I want a better way than pressing Tab after ...
3
votes
1answer
86 views

Search Alt+F2 history

I wonder if there's some way to search the Alt+F2 "runner" history most preferably within the dialog itself. I know that in Cinnamon the values are available in dconf-editor under org.cinnamon ...
5
votes
5answers
341 views

How to search in specific files matching a pattern

How can I find a word in specific files matching a pattern. e.g. searching for version in CMake* files recursively found in the current directory.
1
vote
2answers
67 views

How to show only installed packages by executing “aptitude search”?

After executing the aptitude search pattern command, I need to see only installed packages in the search result. Is there any way to do that?
3
votes
2answers
44 views

Why am I getting so many hits searching for “git” in the aptitude cache?

When I give the following command: apt-cache search git | wc -l I get the answer 756. How can I list just the half-dozen or so apps associated with git?
2
votes
2answers
508 views

Case insensitive search in man pages

Is there a way to search man pages case-insensitively? Using the '/' search feature matches exact case.
0
votes
1answer
112 views

How can I pass in a parameter to sed?

To be more precise - how can I pass in a parameter to a program that then calls sed - how can I 'pass' that parameter along? I have a file 'source_code.sc'. I have a sed script "find_expect": #n ...
14
votes
2answers
265 views

Open man page and search for string in a single command

Instead of doing man chmod and then /a+x to jump to the first section in the chmod man page that mentions a+x, I would like to know if there is a way to open the man page to a specific search string, ...
3
votes
3answers
143 views

How can I search history with what is already entered at the prompt in zsh?

In zsh, I know that I can search history with Ctrl+r. However, oftentimes I start to type a command directly at the prompt, but then realize I should be searching history. When I hit Ctrl+r, it brings ...
0
votes
1answer
431 views

Command to highlight the occurrence of a method in a file? [closed]

How would I do the above? Would it be different for each text editor? Could it be done in the terminal? Thanks
1
vote
1answer
164 views

Binary search for a failing line

git has bisect run to figure out which revision an error was introduced. I have a big file (100GB) and at least one of the lines is bad, but the program I have to check it with will not tell me which ...
3
votes
1answer
4k views

Search text in command output on a PuTTY terminal

I would like to know how to search particular text on the terminal. If I do cat of log files, I would like to find certain words like job or summary so that I don't have to read through the entire log ...
16
votes
6answers
470 views

Reading and searching long man pages

I finally got fed up when wanting to read about bash's read and it's -s option with man bash. I found the right spot eventually (around line 4500), but it was a frustrating as usual, since both /read ...
4
votes
1answer
365 views

How search for a file beginning with either a or z and ending with a or z?

I attempted find -name 'a*' 'z*' '*a' '*z' but it gave me the error code find: paths must precede expression: z* I know how to find files starting with a though z, or ending with a-z, but not ...
3
votes
2answers
209 views

grep entire filesystem blocks on devices

Command grep -rHinF --colour=always -e "aa:aa:aa:aa" / Output grep: /dev/geom.ctl: Operation not supported by device grep: /dev/devctl: Device busy It seems that grep can not proceed because it ...
2
votes
2answers
140 views

find all commands with wh, find by part of keyword in man page

I want to find all man pages for commands that begin with wh. But I do not understand why the following keyword does not work. man -f "wh" Also if I put man chmod in man page of chmod, it ...
1
vote
5answers
2k views

Find files by the length of filename

I want to find all files by length of the file names. For example if I want to find files of length 1, such as a.go, b.go I put: grep '.\{1\}' file But this does not work. What command can I use ...
2
votes
3answers
67 views

Is there html documentation finder/searcher, like info utility for info files?

Many packages have their documentation in html. Is there some sort of man or info utility to find locally installed html documentation and work with it? I mean, I need a program which would ...
9
votes
3answers
466 views

Search for mail content with mutt

Is it possible to use to search for specific mail content using built-in functionality of Mutt? Or, as last resort, how can I configure grep to be used in Mutt ? The documentation only mentions the ...
4
votes
4answers
790 views

vim search numbers containing specific number of digits

I need to find specific length numbers in a big document. I tried to use regex for this. For example, If I need to search for numbers with exactly 2 digits, I use /d/d (i.e. /d twice followed by a ...