A script is a sequence of commands or instructions that are executed by an interpreter program rather than compiled into a standalone executable program.

learn more… | top users | synonyms (1)

6
votes
1answer
308 views

How to change Vim's command type mode programmatically?

Is there a simple way to switch from one command type mode to another without loosing the current command line? In my ~/.vimrc file I remap the <space> and <c-space> character, coming ...
6
votes
1answer
521 views

Can capabilities be used in scripts without setcap'ing the interpreter binary?

Right now I'm using cap_net_bind_service MY_USERNAME in /etc/security/capability.conf. Now I just need to set cap_net_bind_service+i on the interpreter of my favouite scripting language to be able to ...
4
votes
1answer
247 views

vim auto complete custom list

I had these two questions about this function " how do I load a file into a list here? " set some variable func! CustomComplete() " and then read the variable here so that b:list = a \n split ...
3
votes
1answer
146 views

Using tcpdump to log blacklisted IPs

I am using tcpdump to log traffic outbound on a network. I would like to be able to log traffic on a host or IP-only basis but then I would like to be able to log large numbers of potentially ...
2
votes
1answer
79 views

Renaming the files and move to other path

I need to rename the files given below and move to some other path 1234551abcde20140718023216001.txt.809047512.2014_07_07_13:47:44 000001abcde20140718023216001.txt.34568.001.2014_07_07_13:50:44 ...
2
votes
1answer
114 views

Mac equivalent application “shortcat”

There is a mac application called Shortcat and it make me envious. For those of you averse to clicking links here is a summary: Keep your hands on the keyboard and boost your productivity! ...
2
votes
1answer
499 views

Script that unpacks a initrd, allows editing of the preseed.cfg and the packs it to cpio and gzip again

I want to program a script that allows what is said in the title. So basically I gunzip the initrd, than unpack the cpio, open vi to allow editing, save, pack with cpio, and gzip again, so nothing ...
4
votes
0answers
147 views

GRUB 2 scripting: convert device name in GRUB notation into a Linux device name

I'm trying to use partition labels (or UUIDs, that does not matter) to select root partition without use of an initrd/initramfs. With initramfs, this is fairly easy: root=LABEL=... or ...
3
votes
0answers
28 views

How do I schedule a cron task to run

I'm looking to crontab a script every hour starting Friday at 5pm... ending Monday at 5am. This script checks if it's completed this week and if it's currently running. If no/no, start task. Off the ...
3
votes
0answers
143 views

How to make a PAM substack “requisite”?

For the auth section of my PAM configuration, login and mdm etc. call common-auth. I have common-auth calling the following as a substack (as auth substack krb5ldap-cache-auth): auth optional ...
3
votes
0answers
55 views

Notifying program that X session is shutting down

Ok. I understand X session is a bit vague here so let me clarify what I mean by the phrase. I mean the situation where a person has been presented with a display manger screen ( eg xdm, kdm, gdm, mdm, ...
3
votes
0answers
956 views

How do I reset a USB device using a script?

I have a USB GSM modem that does not always work property (Huawei E367u-2) Sometimes it gets reset (USB device disconnect/reconnect in logs) and when it comes back up, it has different ttyUSB numbers. ...
2
votes
0answers
46 views

“Restart” a process in the same terminal?

I put "restart" in quotes because the following question on SO illustrates what I'm trying to do: http://stackoverflow.com/questions/27957091/restarting-a-process-in-the-same-linux-terminal I'm ...
2
votes
0answers
61 views

Copy folders at once

I want to copy a large number of folders at once not one by one. Is it correct to use the following code ? Is it helping to run the command cp for all the folders i at once? #!/bin/bash foreach i in ...
2
votes
0answers
76 views

How can I run a KDE plasma script from command line without GUI?

I want to run a plasma JavaScript file from command line, but the only solution I found so far involves a graphical script editor and requires a user interaction to run the script: qdbus ...
2
votes
0answers
62 views

Remote script cleaning up

I run a remote script using ssh: local script: local_command ssh -p 222 user@server 'sh -s' < ./remote_run.sh remote script: some_command & sleep 10000 trap 'echo exiting' SIGINT SIGTERM ...
2
votes
0answers
133 views

How to print the first three lines and last two lines of a file using perl?

Through the command line I draw one or several of the patterns found text.xml file: perl -ln0e 'while(/<PMResult.*?<\/PMResult>/gs) { $x=$&;print $x if $x=~/BCCEL-[1-3]/}' text.xml I ...
2
votes
0answers
63 views

Automating startup tasks

I have a "morning ritual" that occurs on every boot of my machine: starting up a few browser tabs, starting up skype, starting up terminator and subdividing some screens, etc. Is there any tool that ...
2
votes
0answers
169 views

How to emulate a KWin effect by command line?

I would like to apply the Toogle Invert Effect when I start my system. So, I need to know how to call this KWin effect using the terminal. OBS.: I'd tried xte "keydown Meta_L" "key i" "keyup ...
1
vote
0answers
46 views

script needs to add another loop

script which runs netstat -tulpun | grep -i port_from_the_list & takes the output for running the next command I need to run 2 command on all the server mentioned in the list. server: Jan port: ...
1
vote
0answers
15 views

OCR for getting text from an image. Error management

I want to use an OCR program to obtain some text in an image. The text is not black on white so I don't know if it will be possible. wget -q -O image ...
1
vote
0answers
31 views

Logrotate or scripting to manipulate log file

I want to make sure that a certain log file gets empty when it reaches a specific size. I first used logrotate since the man page says: It will not modify a log multiple times in one day unless ...
1
vote
0answers
31 views

Restore Trash Script not working

I made a script to send a file to a trash folder... echo "Are you sure you want to move this file to the Recycle Bin?" "(Yes/No)" read ans case "$ans" in Yes) echo "$(readlink -f "$1")" >> ...
1
vote
0answers
56 views

Hotmail not receiving emails from a script, but works from the server

I have a working mail server running Debian stable, the following elements are working. SPF DKIM rDNS My IP is not listed in any backlist, I used: mxtoolbox.com for all this. My problem: Sending ...
1
vote
0answers
220 views

How to Download the latest file from SFTP server?

I need to first get the data a file was uploaded to the sftp server on, then check whether it was today's date and if so download it else echo "File not found". I would like to do all this using a ...
1
vote
0answers
44 views

Neutralisation of data from Windows to Unix

I just noticed that other platforms files (Windows) had to cause me many bugs, like here, in my regexes. Mostly, the line ending ^M. There seems to be many ways to do dos2unix, like here described. ...
1
vote
0answers
16 views

Is there a way to run a script right after an account deactivated?

What I want to do is create a temporary user like this useradd -m -e 2009-12-01 -c "Temp Account" tempUser so that when the account expires (like this one would on December 1, 2009), the computer ...
1
vote
0answers
46 views

Need a script to send an email when an input has not changed for more that 30 minutes

I need a linux scrip that will send an sms when there is an input change and it has not gone to the initial state after 30 minutes, I have the following so far, but, I am sure there are few things ...
1
vote
0answers
84 views

Maintain screen session when executing shell script on boot

Solved: I solved this problem by introducing a delay before executing the script: @reboot sleep 60; /root/start_server.sh On Ubuntu 14.04, I have a crontab entry set to run on reboot: @reboot ...
1
vote
0answers
22 views

Is there a version of script that plays nicely with vim?

man script says: Certain interactive commands, such as vi(1), create garbage in the type‐ script file. Script works best with commands that do not manipulate the screen, the results ...
1
vote
0answers
37 views

script works fine on client machine but doesnt work in nagios

purpose: nagios check for kannel stuck Date : dec 8, 2013 /etc/init.d/kannel status | grep -i -E "SMS: received" | awk '{ print $3 }' > kannel_temp_1.txt /etc/init.d/kannel status | grep -i -E ...
1
vote
0answers
46 views

List Mails by subject

I'm writing a script to send mails from a mailbox on a remote server and a script to check if the mails are received at another remote server. For this I have configured mutt. What I now need is to ...
1
vote
0answers
330 views

gnome-terminal cmd leaving processes open after closing parent window

The following simple command should demonstrate my issue: gnome-terminal --tab -t "Tab 1" -e "/bin/bash" --tab -t "Tab 2" -e "/bin/bash" This should open a new window with two tabs and an active ...
1
vote
0answers
129 views

rsstail Not Printing Output

I've installed rsstail 1.8 on my linux box and everything seems to be going smoothly, knock on wood, except for the part where rsstail isn't printing the streams. Running the command, I see that it's ...
1
vote
0answers
657 views

Cron file syntax checker/validator script

Does anyone know a script (bash, perl, php ...) to validate the syntax of crontab files? I found this http://www.intuitive.com/wicked/showscript.cgi?053-verifycron.sh but just Vixie cron notation is ...
1
vote
0answers
93 views

Perl Script to Display Pork Offline Message

I use pork 0.99.8.1 on openSuse 11.4 for my AIM account when I don't want to use irssi + bitlbee. The only problem I have encountered so far is that offline messages are not displayed. I just get a ...
0
votes
0answers
43 views

Increment Numbers in URL?

I want to create a list of URLs. The URLs have two sets of identical numbers which need to be incremented by 1: http://sample.com/poilus/cwrgshs/192/192.html ...
0
votes
0answers
16 views

What's the difference between `set` and `modify` in *nix command syntax

I'm creating a new custom script that will be able to add, modify|set and delete certain rules of DNS records. I was looking for a proper naming convention of *nix tools that might help me name the ...
0
votes
0answers
10 views

Creating a bootable 'system profiler'

I'm trying to create a program using a small linux distribution that can be booted from a USB (kinda how DBAN operates). The program with simple output system specs upon request, no GUI, simplicity is ...
0
votes
0answers
6 views

pop up panel applets

Im using debian 7.7 with gnome classic fallback mode I like how I can put programs and scripts into the panel in custom application launchers. What i want to do is have an analog xclock is fine, in ...
0
votes
0answers
46 views

Copy old cert files and keep the directory path on server

I need to copy old certificate files to new temp directory but keep the directory structure. The certs files are in directories on the server and need to copy all to a temp folder before removing. So ...
0
votes
0answers
57 views

bash script loses readonly value after first time thru loop

I have a bash script which seems to lose the value of the readonly constant after the first time thru the for-in loop. For example: #!/bin/bash readonly DIR="./groups/" for output in "${array[@]}" do ...
0
votes
0answers
55 views

xdotool random/more natural delay?

For automated testing of some applications, I would like to emulate the users behaviour. I know I can user the xdotool type --delay option, but I would like a more natural delay. The easiest thing ...
0
votes
0answers
50 views

shell script for executing mux verilog code

I have a verilog file mux.v and testbench muxTB.v. used ifdef caeses for behavioural model ifdef struct for structural model I have executed these files using the commands iverilog mux.v muxTB.v -D ...
0
votes
0answers
34 views

convert many eps files in a single pdf or ps file using shell scriptI

I have SSt12.OLR.1.eps, SSt12.OLR.2.eps SSt12.OLR.3.eps SSt12.OLR.4.eps ......and covert these eps files into single pdf or post script file. please suggest a shell script.
0
votes
0answers
37 views

Is it possible to auto translate words via scripting language?

Some words in String.log as following: English Home Wait Come Back And I want to translate words of String.log into French,like this: Anglais maison attendez venir arrière As we all ...
0
votes
0answers
62 views

replacement script multiple targets

I have this input file Name=code_229633_138;isoforms=1 Name=code_229633_138 Name=code_229633_138;Target=R77_09738T0 Name=code_230519_1;isoforms=1 ...
-1
votes
0answers
25 views

How to run a script when install a rpm package and answer the installation questions

I will like to know how to install the RPM and answer the installation question automatically if is possible. any ideas.
-2
votes
0answers
33 views

how to get out of PID and port of Solaris 9

Server and the port list are taken from a file "demo", I need the port's process ID to run the ps command. #!/bin/bash while read -r -u10 server port line do echo ========== server: "$server" port: ...
-2
votes
0answers
24 views

Extracting soft clipped sequences

I have a file like this SRR959756.2011 256 20S24M GCCGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAG SRR959756.2011 256 19S22M3S GCCGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAG SRR959756.2011 256 ...