A script is a sequence of commands or instructions that are executed by an interpreter program rather than compiled into a standalone executable program.

learn more… | top users | synonyms (1)

26
votes
7answers
6k views

What Unix commands can be used as a semaphore/lock?

I want to run multiple Bash shell scripts in parallel. However, I want to avoid race conditions. What Unix commands are truly atomic that I could use for this purpose, and how can I use them?
67
votes
6answers
39k views

Allow setuid on shell scripts

The setuid permission bit tells Linux to run a program with the effective user id of the owner instead of the executor: > cat setuid-test.c #include <stdio.h> #include <unistd.h> int ...
0
votes
1answer
10 views

Universal .bashrc alias showing results of sysytemctl start command

This is small .bashrc alias that allows me to see results of starting service alias systemctl start apache='systemctl start apache && echo SUCCESS || echo failure' How can i modify to work ...
0
votes
0answers
37 views

Increment Numbers in URL?

I want to create a list of URLs. The URLs have two sets of identical numbers which need to be incremented by 1: http://sample.com/poilus/cwrgshs/192/192.html ...
0
votes
1answer
9 views

How can I pass a function name to a test runner?

I wanted to write my own test runner: do_test () { function_under_test=$1 expected="$2" function_under_test $3 # <-- Line 32 if [ $result -eq $expected ]; then printf '.' else ...
2
votes
0answers
21 views

Easy command line method to determine specific ARM architecture string?

I'm trying to write a script which will determine actions based on the architecture of the machine. I already use uname -m to gather the architecture line, however I do not know how many ARM ...
0
votes
2answers
31 views

Why do I get Illegal number: {1..3}

Why am I getting ./6_sum_square_difference.sh: 11: ./6_sum_square_difference.sh: Illegal number: {1..3} for #!/bin/sh summing () { the_total=0 num_in=$1 for one_num in {1..$num_in} do ...
0
votes
1answer
43 views

Why does this comparison return not equal?

Can't seem to get this to evaluate to true is_equal () { in="$1" if [[ "$in" == "385" ]]; then return 0 else return 1 fi } a= is_equal 385 if [[ "$a" ]]; then echo "equal" else ...
-1
votes
1answer
22 views

Check exist file on another pc

Yesterday I had ask how to use my tftp protocol in my bash script: Debian - Using TFTP in a bash script And now I have a problem with my tftp protocol. The file who was taken depend of my Hostname. ...
18
votes
10answers
7k views

Object-oriented shell for *nix

Preface: I love bash and have no intention of starting any sort of argument or holy-war, and hopefully this is not an extremely naive question. This question is somewhat related to this post on ...
0
votes
1answer
30 views

Debian - Using TFTP in a bash script

I'm actually using RPiTC (Raspberry Pi Thin Client). I had create a script to see if my Hostname has the same name than a file. And now I want to say "If my Hostname don't have the same name than my ...
0
votes
2answers
29 views

Multiply a column using awk

How do I multiply a column by an integer (say 3) and replace the older value by new one, using awk? Input: Data 9390.900391 10573.089844 80.000000 200.000000 2.700000 Data ...
0
votes
1answer
602 views

How to execute grep in tcl for getting XYZ-123 type pattern

How can I execute this grep command in TCL? grep '[A-Z][A-Z][A-Z]\-[0-9][0-9][0-9]' file1 > file2
2
votes
2answers
4k views

grep output of expect script

I'm trying to run some expect language, and grep/parse the output all in one script. I want to grep the output of and look for "error" (I should note that standard linux commands like awk, sed, grep, ...
-2
votes
2answers
24 views

How to use shift to shift $@ one over

I am running a shells script with 3 arguments. I am getting the word count of each one. But I want to skip over the very first argument, maybe by using shift or something else. Most of the examples ...
1
vote
1answer
17 views

Compare two Arrays in KSH and output the difference

I am not extremely familiar with KSH (Actually just started using it) and I am having problems with trying to create a script that will essentially compare two arrays that have been stored and then ...
0
votes
1answer
30 views

How to make $@ start one iteration ahead

I'm running a bash script and am reading file contents of each one, but I want to skip the first one. I know of the "shift" command, but I'm having trouble getting it to go one over. I currently have ...
-5
votes
0answers
41 views
1
vote
3answers
41 views

How to access the contents of a file that is used as an argument when running a bash script?

I am running a bash script with its parameters/arguments as files. From inside the script, how do I get the contents of those files? I run the script with this command line: sh script_name ...
1
vote
1answer
13 views

Automatically find position, from what last command started in tmux

It is common practice in tmux to start some command, then switch to copy mode, scroll to the position, where is this command started and look over the command output. It is difficult to find the ...
-4
votes
1answer
59 views

Merge two csvfiles by column header

I have two csv files: success.csv "ID","Legacy ID","Field1", "Field2" 1,1111,google,news 2,2222,yahoo,news error.csv "Legacy ID","Field1","Field2","Message" 3333,aol,news,"Failed to upload ...
1
vote
1answer
42 views

Using cURL, How can I fetch a numerical string which contains commas and spaces and convert such to a NON COMAFIED string [duplicate]

Example: Google's Outstanding Shares are 670,000,000 and this value is collected in a txt file from Yahoo Finance API using the below script. The issue is; that numbers WITH commas or spaces are ...
-2
votes
2answers
25 views

extracting only the domainname, port number of first path

str1="https://111.111.111.111:2222/cpsess8993738132/scripts4/listaccts/" str2="https://111.111.111.111:2222/cpsess8993738132/" ...
0
votes
1answer
1k views

How to execute Netscaler commands through a remote machine via SSH connection

I have been trying to execute some NetScaler commands like "bind" & "unbind" through a Linux Box via an SSH Connection. Now the Problem is, Manually we are able to enter & execute commands on ...
0
votes
2answers
49 views

Running a program (command) on terminal after login screen in Ubuntu 14.04

NOTE :- This is not a duplicate question. I have searched about 100 times on this site and several others including Ubuntuforums,askubuntu and stackoverflow. I couldn't get my work done. OBJECTIVE :- ...
9
votes
4answers
18k views

printing colored text using echo

I know that for printing a colored text using echo, for example red color, the code is: echo -e "\e[1;31m This is red text \e[0m" and I know that in this example, 31 is code of red color and the ...
9
votes
2answers
259 views

When is it important to write portable scripts?

Most code I write is in PHP. I have recently started learning shell scripting. Most of the resources and tutorials that I've come across are specific to Bash. Some warn about bashisms and some don't. ...
2
votes
5answers
4k views

Bash eval array variable name

Here is my bash case: First case, this is what I want to do "aliasing" var with myvarA: myvarA="variableA" varname="A" eval varAlias=\$"myvar"$varname echo $varAlias Second case for array variable ...
0
votes
2answers
26 views

I'd like my script to interpret links when processing files

> ls -l aliasedname lrwxr-xr-x 1 anon3202 users 19 Dec 25 05:24 aliasedname -> www/realfilename I'd like for my script to return details about ~/www/realfilename when it's fed information ...
1
vote
2answers
32 views

Help with Script to Process txt file to CSV

I am trying/attempting to write a script to turn this: Mikrotik01#show unique routing entry | 192.168.255.232 | inc ID Thu June 10 15:21:32.808 CST Unique Entry: 192.168.255.21 Unique Entry: ...
-2
votes
0answers
31 views

how to get out of PID and port of Solaris 9

Server and the port list are taken from a file "demo", I need the port's process ID to run the ps command. #!/bin/bash while read -r -u10 server port line do echo ========== server: "$server" port: ...
0
votes
1answer
32 views

unable to read the output to run the next command [closed]

When this script is executed I get the PID. Now I want to read the output "PID" and run the next command in this way: ps -ef | grep -i PID ps -ef | grep -i PID while read -r -u10 server port ...
2
votes
0answers
45 views

“Restart” a process in the same terminal?

I put "restart" in quotes because the following question on SO illustrates what I'm trying to do: http://stackoverflow.com/questions/27957091/restarting-a-process-in-the-same-linux-terminal I'm ...
1
vote
0answers
46 views

script needs to add another loop

script which runs netstat -tulpun | grep -i port_from_the_list & takes the output for running the next command I need to run 2 command on all the server mentioned in the list. server: Jan port: ...
1
vote
1answer
31 views

remove a portion of a line contained within two different types of separator / delimiters [duplicate]

Most of the commandline tools I'm looking at have the ability to pick a field delimiter. However, I'd like to pick one delimiter to start, and a different one to end the segment of text I'd like to ...
3
votes
0answers
28 views

How do I schedule a cron task to run

I'm looking to crontab a script every hour starting Friday at 5pm... ending Monday at 5am. This script checks if it's completed this week and if it's currently running. If no/no, start task. Off the ...
1
vote
2answers
19 views

remove lines from an output file from diff

I have a script that uses diff -c then puts the output on a text file. What I want is to remove the line that does not have the "!" and display the lines with the exclamation mark. Is this possible? ...
-1
votes
2answers
37 views

Script which takes details from file & runs command

It would be helpful to understand how can I connect the second column in the script. currently using the below for loop for i in cat server do echo ===$i==== ssh -q $i 'netstat -tulpun ...
2
votes
4answers
90 views

Fastest way to read last line within pattern of multiple files with the same extension

I have in a directory /home/files/ some files that all have the same extension .txt. For example 1.txt 2.txt 3.txt 4.txt 5.txt test.txt These files are all the same in data format but the data are ...
1
vote
1answer
29 views

I'm copying if-then statements, with slight variations… and I shouldn't have to

I know there's a better way to do this, I'm just not looking in the correct place to figure it out. I have a number of these type of statements (say 1-100, or a list of different filenames). ...
2
votes
2answers
515 views

Change a value in a config file, or add the setting if it doesn't exist?

When modifying config files from the command line, I often want to find the setting in the config file and modify that line if that setting exists. If that setting doesn't exist, I want to add it to ...
-3
votes
1answer
1k views

How to show the percentage progress of script execution in Unix?

Suppose you run some script such as a perl or tcl. For example, $ ./script.sh; ./script.pl; source script.tcl. It takes some time to get executed and return to prompt. How to display the percentage ...
0
votes
1answer
64 views

How do I put a checksum in a script?

I was (am) having trouble installing Eagle on my Linux (debian 8 jessie) computer. I was reading the installer script, when i noticed there is a checksum for the install script in the install script? ...
0
votes
2answers
49 views

Whats wrong with this case statement?

UPDATED: I am trying to do some color changes with my keyboard using apexctl depending on what time it is. But my case statement is giving me trouble. I want to compare the time when the script runs, ...
4
votes
3answers
413 views

Should I be using 'sudo' in scripts that I write?

I'm setting up a new machine (well actually, an Ubuntu VM) and am trying to write a script to setup a few common things that I use when doing this (Git, curl, vim + janus). So my script looks a bit ...
12
votes
3answers
10k views

Confusing use of && and || operators

I was skimming through an /etc/rc.d/init.d/sendmail file (I know this is hardly ever used, but I'm studying for an exam), and I've become a bit confused about the && and the || operators. ...
-2
votes
0answers
24 views

Extracting soft clipped sequences

I have a file like this SRR959756.2011 256 20S24M GCCGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAG SRR959756.2011 256 19S22M3S GCCGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAG SRR959756.2011 256 ...
3
votes
3answers
3k views

How can I print only certain commands from a bash script as they are run?

I have a bash script with various if statements based on command line arguments I pass in when calling it. Having some kind of output as to what commands are being run is helpful to confirm the flow ...
2
votes
2answers
474 views

Import single rows from SQLite to MySQL?

I need to do some kind of incremental import again and again from a SQLite 3 database to a MySQL database. Column names are the same in both databases. Is there a good way to do this by a script ...
0
votes
0answers
16 views

What's the difference between `set` and `modify` in *nix command syntax

I'm creating a new custom script that will be able to add, modify|set and delete certain rules of DNS records. I was looking for a proper naming convention of *nix tools that might help me name the ...