grep is a command-line tool for searching text patterns in files

learn more… | top users | synonyms

1
vote
4answers
39 views

Is there a way to grep a folder and show all lines containing non-ascii characters?

Some code I am working with has a bunch of comments written in Japanese and I am working on translating them to English. Is there some way to "grep" for all lines containing Japanese characters or at ...
1
vote
2answers
28 views

grep or find a pattern in all directories [duplicate]

I have an account number 1234-5678, I am trying to find it in all files of directories. I used the below command but no result found. grep "1234-5678" */ Please can someone help me how to find it in ...
3
votes
1answer
19 views

Extracting 1st word after matching when matched word has []

I have an issue when I try to extract the 1st word after grep matches my pattern . Let me show you an example : cat test.txt [profile dev] xxx xxx [profile prod] xxx xxx now I want to extract the ...
4
votes
1answer
34 views

ack.pl tool and ack.pl flags

I am using the ack.pl tool in order to search string or IP’s in files The official site of ack.pl is - http://beyondgrep.com/documentation/ Example of ack.pl CLI ( want to find the string ...
3
votes
5answers
261 views

How to grep the n-th substring between given delimiters?

Let's say we have a string and its delimiter is ?: Leslie Cheung April 1 ? Elvis August 16 ? Leonard Nimoy February 27 I know how to grep the first substring between delimiters: echo $above_string ...
2
votes
1answer
273 views

grep behaving abnormally

grep is behaving different when letter a is being searched. when letter a is included in search criteria, it is not searching for any other letter. But it is not the same case with other characters. ...
0
votes
3answers
35 views

grep log lines of a specific id request

So, I have the following log sample: 2015-03-30 10:19:44,200 DEBUG [Default : 1] [Application:ABC BIW: IDA:6d87de8e-1276-4496-b49d-dd4cd375cbe4 Info:P23 Code:ABCD] A log message 1 2015-03-30 ...
0
votes
2answers
52 views

How to print an element from the corresponding immediate next column after searching the element in the current column?

I have thousands of lines as seen in the following list. file name = "textfile" 3 2 3 1 4 7 5 8 6 8 9 8 8 9 4 7 3 9 2 3 4 4 9 2 2 2 0 9 4 0 0 9 8 2 4 0 I have to search a particular element – ...
2
votes
2answers
38 views

grep with count of individual patterns

I have a file with MAC addresses (1/line with : as separator, sorted) and I need to find out how many times each of these MAC addresses appears in the file. I modified this: How to count occurrences ...
1
vote
2answers
42 views

Parsing C Style Multiline Comment

I want to filter non-commented javascript with sed and output the line number Here is the example: /*! * jQuery UI 1.8.17 * * Copyright 2011, AUTHORS.txt (http://jqueryui.com/about) * Dual ...
2
votes
3answers
166 views

Print total free memory from `free -m`

free -m currently puts out something like this. I would like to know using grep/awk how we can get the total free amount. i.e. 9083
15
votes
8answers
9k views

pgrep and pkill alternatives on mac os x?

Are there alternatives to pgrep and pkill commands on Mac OS X or should I just create aliases for them using other commands available for me?
2
votes
3answers
104 views

How can I extract the text between two strings in a log file?

I think I have a very similar question to this one but I see it was closed due to being unclear so I'll create a new question. I've got a log file that contains one-line entries with multiple ...
-1
votes
1answer
38 views

Is it possible to get static backreference with grep?

I try to match a a group twice in multiline. grep -Pz 'Source: (?<group>.*/).*\n.*\n.*\n.*\k<group>|$' it work except one major problem - it doesn't, \k<group> search for .*/ and ...
3
votes
4answers
6k views

Compare two text files and find matching lines

I have two files A and B. A looks like this (4 to 6 lines): GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT ...
18
votes
2answers
1k views

Why is “grep keyword” causing the terminal to stand by forever?

When I type "grep doc" in the terminal, it just don't do anything, stopping the terminal from doing anything else before I escape using Ctrl+C or Z. I know this isn't how I'm supposed to use grep, ...
0
votes
1answer
882 views

How to execute grep in tcl for getting XYZ-123 type pattern

How can I execute this grep command in TCL? grep '[A-Z][A-Z][A-Z]\-[0-9][0-9][0-9]' file1 > file2
2
votes
3answers
129 views

find and grep pipeline returning nothing

I have files named lect1.txt, lect2.doc, and lect3.doc. I want to get a file which is a .txt file, and contains lect as the filename. I tried find *.txt | grep lect* and it returned nothing. ...
0
votes
1answer
49 views

can we get sorted grep output

I have same: 1.txt with apple written in it, 2.txt with mango written in it, 3.txt with apple written in it, 4.txt with mango written in it. grep -e apple -e mango *.txt will give result as: 1.txt: ...
2
votes
2answers
56 views

Live replacement, while viewing log using LESS

It's very convenient to monitor logs using less command - you see what is going with your system as it happening. The bad thing is that my logs are optimized for grep tool: each atomic action is ...
0
votes
1answer
41 views

Search a file for a string in multiple directories

Can someone please help me with a command to search a file for a string in multiple directories? I am searching for the VIP in httpd.conf in multiple httpd instances. I am using: find ./ -name ...
0
votes
6answers
49 views

How can I use grep to search only on the first line of files for a specific string?

How can I use grep to find a string in files, but only search in the first line of these files?
0
votes
1answer
40 views

What's a way to get the first network interface using grep in ifconfig? [closed]

Just trying to figure this out for a System Administration introduction course, and I can't seem to get it.
0
votes
1answer
28 views

Using regular expressions to search a word list. Finding 2 letter words instead of 3. Why?

I am studying regular expressions and I am stumped. Here is my process so far.... I downloaded this file. wget http://www.mieliestronk.com/corncob_lowercase.txt mv corncob_lowercase.txt words.txt ...
5
votes
2answers
2k views

tr complains of “Illegal byte sequence”

I'm brand new to UNIX and I am using Kirk McElhearn's "The Mac OS X Command Line" to teach myself some commands. I am attempting to use tr and grep so that I can search for text strings in a regular ...
0
votes
1answer
23 views

Cron start script twice

I have a backup script which sends my snapshots to a off-site location. 0 0 * * * /root/backup/backup_incremental >> /root/backup/test.log For some reason my PID file which should stop the ...
1
vote
1answer
29 views

Grep rows where change occurs in columns

I'm wondering if there is a grep command to return the row lines where a character in a column changes... for example if I have a file: 1 1010 1 101010 1 10101010 2 1010 2 101010 2 10101010 And I ...
13
votes
2answers
52k views

Return only the portion of a line after a matching pattern

So pulling open a file with cat and then using grep to get matching lines only gets me so far when I am working with the particular log set that I am dealing with. It need a way to match lines to a ...
2
votes
4answers
118 views

How do I perform xargs grep on grep output that has spaces?

I'm searching for files based on a regular expression, and then I'm trying to search those files for content. So, for example, I have something like #Find all C++ files that match a certain pattern ...
7
votes
2answers
10k views

How to grep lines which does not begin with “#” or “;”?

I want to grep smb.conf and see only lines which are not commented.
0
votes
2answers
50 views

grep with variable

I am trying to create a script to monitor all logins using sudo, both success and failure. Right now, I have: set tdate = $(date "+%b %d") set attempted_su_log = /var/log/suattempts cat ...
8
votes
3answers
9k views

How to return both file name and line number with find … -exec grep?

When using find, how do I return the file name and the line number when searching for a string? I manage to return the file name in one command and the line numbers with another one, but I can't seem ...
1
vote
6answers
90 views

filter out length

I have a file which contains 3940 sequences and looks like >TCONS_00000066 gene=XLOC_000030 CCGCCGGCTGCTGCGCGCACCGACTTGTCACCACCCCAGCACGTCCTCCACGTATACAAG ...
6
votes
4answers
501 views

Can I use Find and Grep in one line

I am a complete novice in UNIX and desperately need some help. I have a directory structure based on events. In these events I have one type of file which does or does not contain a pattern for ...
1
vote
4answers
67 views

How to search the word after the specific line in the file in linux?

I have a file with 100 lines and i have to search the word happy but the search must start after the 50th line of the file. what's the exact grep command is used in linux?
4
votes
4answers
134 views

Insert new lines with missing values (NA)

I would like to insert new lines in text files if there are missing values. I have for example the following text file (A.txt), for which line 5 is missing. In addition, as the file should have 12 ...
1
vote
2answers
77 views

Search only in plain text files that are not source code

I use following command to search for string ELF in plain text files under the current directory recursively: grep ELF -r . but it also searches in binary files (e.g. zip file, PDF file), and in ...
2
votes
2answers
45 views

Find out on which line in text file is matching word

Is there any way to find out on which line of the text document is some word which is matching pattern for example with grep or something. Thanks.
1
vote
2answers
275 views

How to put $@ in quotes?

My bash script looks like this: #!/bin/bash grep -r --color=always $@ . | nolong The file is saved in /usr/bin/findstr Everything's ok when I run this: findstr hello But when I run this: ...
1
vote
2answers
69 views

Why is grep searching more than the files I want with asterisk?

Deep within a bash script I have grep -Ech 'string1|string2' /server/directory/$servername_log_20150312* | awk ... I was getting the "too many arguments" error so I turned on set -x and I see that ...
0
votes
1answer
26 views

Find a file that doesn't include specific characters

I want to find a specific file that doesn't start with a,k,G or Q and in which the third letter in the name is not a digit. I have tried many links, but found nothing regarding to this composite ...
1
vote
2answers
4k views

How can I use grep to search multiple unnested directories?

It may sound like I'm asking the same thing as this question, but I have different requirements. This is an example of my filesystem: /code/ internal/ dev/ main/ public/ dev/ main/ release/ ...
3
votes
3answers
248 views

Output to be saved in file named same as the input file [duplicate]

I have one input file and run some command but want the output to be saved with the same name as the input file has. I tried below command but it makes the output file blank: cat file1 | grep ...
-2
votes
2answers
32 views

grep to get all the getters from a java file

I have a java file called Friends.java . There are 5 variables and each variable has its own getter. Assume that all the functions below follow standard java standard, i.e public methodName(){ //Some ...
2
votes
3answers
163 views

Keep a tally from a log file

I have a file called output.log which has this content: Thread started Thread finished Thread started Thread finished Thread started Thread started I monitor its output using: tail -f output.log ...
0
votes
0answers
19 views

Grep not writing output until end of input [duplicate]

I have some script that is taking a long time, and producing a lot of output. I want to send the full output to one file, and pick out some specific lines to be directed to another file. Since it ...
2
votes
2answers
506 views

Matching two files for similar first line

I have 2 set of files. File one contains ID's ex: 1111 2222 6666 3333 4444 File two contains ID and username: 1873 Neil 1111 Roger 7632 Tim 3333 Oscar 8723 Greg 4444 Roy 6666 Patrick I want to ...
1
vote
2answers
29 views

How would I grep for a password file entry without using 'username'

Can a who command be integrated to find the current logged in users password file entry?
0
votes
1answer
25 views

grep recursively in ksh on AIX [duplicate]

How do I grep recursively in directories and sub directories in ksh on AIX? I have tried grep -r but this is not available.
0
votes
2answers
48 views

Not getting grep with a variable

I am assigning a variable to echo command which generates a random number. For eg: n=$(echo $(( (RANDOM%6) +1)). I have to grep this variable in /etc/passwd. So, my syntax reads like: n=$(echo $(( ...