-1
votes
0answers
17 views

Rearranging text file with blocks of data [duplicate]

I have a file whose content looks like this: 2009 150 0 0 0 0000 75.316 0.0400390625 0.00007 0.00000 0.8980 76.216 0.0400390625 0.00007 1.00000 0.9046 77.217 ...
3
votes
4answers
129 views

Rearrange text file by prepending data rows with header row

I have a file whose content looks like this: 2009 150 0 0 0 0000 75.316 0.0400390625 0.00007 0.00000 0.8980 76.216 0.0400390625 0.00007 1.00000 0.9046 77.217 0.0400390625 ...
0
votes
2answers
53 views

Extracting with grep/sed a first pattern and then a second pattern that occured some lines before and related to the first

I'm trying to extract a specific line from a .htm file when a pattern occur ("Event 100" in my example below) but at the same time I need to retrieve also another pattern which is related to the first ...
3
votes
4answers
202 views

extract the characters before () using grep

I need to extract the characters before the character '('. My file structure is: rose(good)ook daisy()no lilly(bad)fine sunflower()nice I need output file as in the form of: rose ...
1
vote
1answer
51 views

Remove the string before the whitespace

I want to remove a word before the whitespace. My file structure is: ant tiger static rabbit lion dynamic monkey donkey I need the output as: ant tiger rabbit lion monkey donkey ...
1
vote
3answers
53 views

Extract part of string using grep

I have 3 files in a directory MYO144064T MYO144064TA MYO144064TX Where the digits and 11th character will change. In my csh script, I want to extract the letters 'A' and 'X' probably using grep ...
3
votes
4answers
125 views

Identifying genes from a list of genes

I have a gene list file. Some thing like this SWT21 SSA1 NRP1 EFB1 TFC3 MDM10 I have another file which also contains the names of these genes in my list along with other ...
2
votes
5answers
89 views

identifying words in file 1 and matching them to second file and printing them

I have two files as follows File 1 has list of Ids ram Tarah taikah jhdfklj File 2 has id=ram;*between*hkjhdswklf kjsdklhglshglkhgklsdgkhdfg id=taikah;jhdjfkhg**kjdfkjksfdjk ...
2
votes
4answers
87 views

Compare two text files and find matching lines

I have two files A and B. A looks like this (4 to 6 lines): GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT ...
-1
votes
2answers
46 views

How to extract submatches from a string and write those to a file?

I want to parse a string for specific submatches and output those - one submatch per line - into a file. Essentially I would like to extract the value of each href-attribute: $ cat Fin <a ...
2
votes
3answers
97 views

How to show CPU time for processes via top without 'root' procs

Okay, So I've been attempting this for about three hours now without success. How do you search/display/use the top command (or ps command if it works...) to output a list of all procs, sorted by CPU ...
0
votes
4answers
53 views

What are alternative tools for searching files in full content?

I realized that most of the text related tools I use, grep/egrep/awk/sed are line-oriented. I guess that is a simplified approach to search in files but I was wondering if there is another set of ...
1
vote
2answers
53 views

comparing user given time for log file time

Apologies straight away for bad-styled-question-and-heading.....learning unix and its command these days, m trying to figure out a solution for below scenario : Lets say i have a log file which ...
1
vote
1answer
36 views

pcregrep fails due to segmentation fault

I am extracting the HTML source of a web page using the below command. curl http://www.linkedin.com/pub/ramesh-venkataraman/63/621/b42 -s | w3m -dump -T text/html > foo.txt The foo.txt has the ...
0
votes
3answers
133 views

Awk/grep/sed get comma separated list of numbers from lines of text

I have a log file that has lines that look like this: blah blah blah Photo for (702049679 - blah blah blah Now I know I could get all the lines like that from the file by doing: grep "Photo for" ...
1
vote
7answers
211 views

Sed / Awk - Find string exactly n characters long

Looking through the man pages for sed, awk and grep, I'm unable to find a way to search for a string that is exactly n characters long. Given the following text file, I want to extract just ...
2
votes
1answer
45 views

Matching two different lines that are at least N lines distant from each other

I would like to match files that contain try (in one line) and consecutive catch (in another line) at least N lines later (to find very long try-catches and try to get rid of them). I mean, the first ...
4
votes
5answers
286 views

Pattern matching across multiple lines

What is a quick and easy way to validate if the pattern "301 domaname.com 200" is present within BASH when spread across multiple lines of output? I was using something like the following: awk ...
1
vote
2answers
51 views

Replace “-from” with “this” in the begining of line

I want to replace "-from" with "this" in the begining of line. This should happen when that line has 'R' at the end and line above it has "D" at the end. For example for the block shown below: ...
2
votes
6answers
218 views

Remove lines that do not start with a pattern from a given set of patterns

I have a file that contains data like this: report aaaaaaaa - .. -th bbbbbbbbb -to ccccccccc .. --. Question: I want to remove any line that does not start with following strings : report ...
2
votes
1answer
76 views

replace text after match

aaaaaaaaa bbbbbbbbb -th ccccccccc_RD \ DDDDDDDD FFFFFFFF -th GGGGGGG_RD \ using sed/grep/awk etc, In the above text, if a line ends with "RD \" , replace "-th" with "-to" at the ...
1
vote
3answers
319 views

Using sed/awk to remove anything after first space

aaaaaaaa 09 bbbbbbbb 90 ccccccccccccccc 89 ddddd 09 Using sed/awk/replace, in the above text I want to remove anything that comes after the first space in each line. For example the output ...
3
votes
1answer
147 views

grep on line before the match plus the match

zzzzzzzzz aaaaaaaaa bbbbbbbbb & ccccccccc & ddddddddd hhhhhhhhh eeeeeeeee fffffffff & ggggggggg & in the above line, what i want is to grep/sed/awk (any method is fine) line that ...
4
votes
5answers
176 views

Multi-line grep beween two tags, only show the last match

I'm having a program that intermingles data segments into log output: log message log message ----BEGIN INLINE DATA---- data data data -----END INLINE DATA----- log messge I'm looking for something ...
4
votes
2answers
653 views

recursive search for a pattern, then for each match print out the specific SEQUENCE: line number, file name, and no file contents

What I am after is almost exactly the same as can be found here, but I want the format "line number, separator, filename, newline" in the results, thus displaying the line number at the beginning of ...
1
vote
1answer
164 views

How to use awk or sed to convert csv diffs into more readable format

Can anyone give me the example of how to use awk or sed (not sure which one, as I haven't use either of these much, as I have mostly been using grep and cut to work with csv data) to convert ...
12
votes
8answers
792 views

How to perform a multi line grep

How would you perform a grep for text that appears on two lines? For example: pbsnodes is a command I use that returns the utilization of a linux cluster root$ pbsnodes node1 state = free ...
1
vote
1answer
99 views

Retrieving two matches from repeated pattern

How can I retrieve matches from two repeated patterns: mappedname & its value in the text below?. MapName:abc someDiffName=someDiffValue x=3 y=6 NeedyMappedName=NeedyMappedValue . . Flag=true ...
6
votes
5answers
221 views

Get filesystem name and usage with `df -h`

df -h | grep test | sed -e 's/*%.^ //g;s/.*[ ^I]//' Output: /test /test/drv0 /test/drv1 df -h | grep test | cut -d '%' -f1 | sed -e 's/*%.^ //g;s/.*[ ^I]//' Output: 10 20 15 I want to ...
2
votes
4answers
134 views

AWK Search massive file and write to variable name

I want to pull data that I will need to reformat from a simulation file I am working with to prepare it as input for running other simulations. The target data is an optimized chemical z-matrix. The ...
9
votes
2answers
606 views

Script to quickly test all keyboard keys

I need to check some notebooks for bad keyboard keys, and so I'd like to speed that up as much as possible. I found nothing for this specific task, so my idea is a script that reads the pressed keys ...
10
votes
5answers
950 views

Using grep or awk

To capture a particular pattern, awk and grep can be used. Why should we use one over the other. How does this work in the background? Which is faster and why? E.g If I had a log file and I wanted ...
4
votes
1answer
176 views

grep: display filename once, then display context with line numbers

Our source code has error codes scattered throughout. Finding them is easy with grep, but I'd like a bash function find_code that I can execute (eg. find_code ####) which will provide output along ...
1
vote
3answers
130 views

Cat 2 files and avoid duplication of lines

I have the file1 with the following content {"name":"clio5", "value":"13"} {"name":"citroen_c4", "value":"23"} {"name":"citroen_c3", "value":"12"} {"name":"golf4", "value":"16"} {"name":"golf3", ...
0
votes
4answers
1k views

Extract substring using regular expression on a Unix file

I have file with below contents . /ABC/RTE/AD_900_VOP_123/OPP /ABC/RTE/TRE/AD_900_VOP_145/BBB /ABC/RTE/AN_900_VFP_124/FBF /ABC/RTE/HD_900_FOP_153/WEW /ABD/RDV/AD_900_VOP_123/OPP ...
1
vote
2answers
77 views

Grep and sort several unsorted things in several lines (in one document)

I have a file with several unsorted things in one line which I want to put into a new file This is an example of part of the file I have: X1314448: SaMi|SM_g2554.t1 SaMi|SM_g5072.t1 Des|Des_g3808.t1 ...
3
votes
1answer
321 views

Output of `java -version` not matched by grep or awk

On my Linux machine, it isn't clear to me why if I do the following then I don't get only the version string ("1.5.0_32"). # java -version | grep version | awk '{print $NF}' java version "1.5.0_32" ...
1
vote
2answers
236 views

How to count the number of words and print the lines that match exactly a given pattern?

I want to count the number of words and print the matched pattern lines which matches exactly with following pattern: abc-ERROR: The input File contains: # abc-ERROR: xyxxkkfgfr # def-Error: ...
2
votes
3answers
250 views

awk, sed, grep, perl… which to print out in this case?

I have this syntax in a file (http response times from analog): <thead><tr><th class="x">seconds</th><th class="R">reqs</th><th ...
1
vote
3answers
379 views

Newbie struggles with grep, sed, awk to filter html

I am a beginner linux user, trying to teach myself how to use linux tools on a cygwin install. I decided to make up a project to try to teach myself the basics of shell scripting and simultaneously ...
-2
votes
1answer
224 views

Search low values in mainframe files

I am working with mainframe files and it seems that the low values (x'00') exists in the records in the file which throws off my import for fixed block. Does anyone know how to eliminate those ...
3
votes
2answers
220 views

sort a file based on length of the column/row

I need to sort a file based on the number of chars in the first column. I have no idea on how to go about this. (On Linux, so sed/awk/sort is available). An example: .abs is bla bla 12 .abc is bla ...
1
vote
2answers
547 views

Parsing string by awk and get only elements without pipes or semi colons

I would like get this string line AUGUSTYN|Stanisław|3589238 without | and : I tried something like that: cat baza|grep "AUGUSTYN" -n|awk -F '|' '{print $1,$2,$3,$4}'` (baza is my file with ...
3
votes
5answers
171 views

grep device name and look for next value :

I have this output from a find command: abc,10.11.13.14,def,1.2.3.4,geh,6.7.54.23 where abc,def and geh are device names and could be of any length and others are IP address belong to devices. ...
2
votes
3answers
397 views

Regex/pattern matching problem to extract data

What is the best way to remove distances in the following lines and output cdv format. Can this be done reasonably easily on the command line? I'd like to avoid having to write a full-blow script. ...
1
vote
3answers
2k views

bash merge 2 lists removing duplicated

I have an embedded linux system using Busybox (OpenWRT) - so commands are limited. I have two files that look like: first file aaaaaa bbbbbb cccccc mmmmmm nnnnnn second file mmmmmm nnnnnn ...
2
votes
3answers
963 views

Average rows with same first column

Given a file with two columns: Id ht 510 69 510 67 510 65 5l0 62 510 59 601 29 601 26 601 21 601 20 I need a way to coalesce all rows with the same ID into one that has an average height. In this ...
0
votes
5answers
3k views

compare two files get identical list

file1.txt (50 lines) TERYUFV00000010753 TERYUFV00000009526 file2.txt (500 lines) TERYUFV00000009526 refids_739_known_8/10_target TERYUFV00000018907 refids_12023_known_21/22_target ...
3
votes
2answers
692 views

What is the best way to find a list of several strings within a large text file

The short, general question is: In Unix/Linux, what is the best way to find a list of several (about 150) strings within a large text file? I am asking this to all Unix/Linux experts as a general ...
2
votes
3answers
107 views

Need to parse a double entry table with two pairs

I have this two-entry table resulting from a program output: Variable1 : Value1 Variable2 : Value2 Variable3 : Value3 Variable4 : Value4 Variable5 : Value5 Variable6 : Value6 ...