5
votes
2answers
115 views

Is there a way to make this one-liner faster?

Context I have a directory of thousands of zip files that are dated in the form YYYYMMDD_hhmmss.zip and each about 300K. Within each zip file is about 400 xml files each about 3K. The problem I ...
6
votes
5answers
227 views

Strategy to extract movies's name from this ununiform dataset?

I am working on a movie database problem to improve regular expressions, this is the problem I'm running into. My dataset looks like this: Movie Name (variable space and tabs) year Movie1(can ...
5
votes
2answers
66 views

Grepping for a block of text with parts that can be optional

I have multiple entries that describes an event in a very large log file, say A.log. I would like to do two things with the event entries in the log file: Count the number of occurrences of each ...
1
vote
4answers
52 views

Printing a new line using awk

I have a load of files in which I need to take out specific rows and then put the data I've taken out into a spreadsheet. An example would be my file shows: Name: w Age: x Height: y Weight: z I ...
1
vote
2answers
122 views

Extract Values from simple html file via grep/awk

I have another grep/awk/sed issue within the attached HTML code below. Given is a simple HTML file with table inside. The HTML is generated by a smart meter (household energy meter). Inside the html ...
6
votes
8answers
574 views

Grep rest of line…after match

I have a file containing only two lines, with the following structure: $ cat /tmp/pwpower.log 000D6F0000D34227, -114.10 000D6F0001A405C4, -130.09 The values are power values of my solar plant. ...
1
vote
3answers
155 views

GREP / SED or AWK: Print entire paragraph in a file on pattern match

I have a file with hundreds of paragraphs of around 15 lines each. I need to search for a pattern, say Occurance: 1. If this pattern is found in the para, I need to print the entire paragraph. Note ...
3
votes
3answers
105 views

How can I get the first column of a 300GB txt file?

let me first explain my problem in detail. It's actually pretty simple. I have a huge .txt file, 300GB to be more preciese, and I would like to put all the distinct strings from the first column, that ...
5
votes
3answers
434 views

What are the exact differences between awk and cut with grep? [closed]

We know that we can get the second column of the line we want from a file using these two techniques: cat fileName | awk '/WORD/ { print $2 }' or cat fileName | grep WORD | cut -f 2 -d ' ' My ...
0
votes
4answers
158 views

Search for a Value only in one column w.o using awk, sed, or perl

I have a file that looks like this : Marketing Ranjit Singh FULLEagles Dean Johnson Marketing Ken Whillans FULLEagles Karen Thompson Sales Peter RobertsonPARTGolden ...
0
votes
1answer
83 views

Duplicate specific text in text file, using perl or grep

I need to duplicate part of a plain text file as follows: The text file consists of a sequence of "pages", of the form: <page [lots of lines of text] /page> <page [lots of ...
3
votes
2answers
76 views

how to grep complex hierarcy?

I have a file as:- start apple 1 a 2 b 3 c start orange 4 a 5 b start mango 1 a start a/b/c 5 z end 4 b end 6 c end start banana 3 c end 4 d 5 e end I want the output as :- 1 apple/a 2 apple/b 3 ...
1
vote
2answers
70 views

Parse,Manipulate Data In linux/Unix

I want to have exactly the same output in this post(http://unix.stackexchange.com/questions/126139/extract-data-in-linux-unix)as above,but I have a new input file,which is below: ABCB11 4 ACE 11 ...
1
vote
2answers
164 views

Extract data in linux/unix

I have input data which I want to parse and extract values using awk/grep/sed: group-2 9 10 text color=black,from=ABCB11,fromid=4,order=2,thickness=3,to=ACE,toid=11,use=1,z=1 group-3 0 1 text ...
2
votes
1answer
235 views

Regex doesn't work with grep

I have a string like this TEST="/dev/sda1 on /media/sda1 type vfat (rw,relatime,fmask=0000,dmask=0000,allow_utime=0022,codepage=cp437,iocharset=iso8859-1,quiet)" (Result from mount | grep sda1) ...
0
votes
2answers
136 views

Compare first column in different files

I want to compare one file with other files in the same directory. file1.txt contains: move 34#123# get 11#278 put 33#29#567#23 file1.txt should compare with files 1.txt and 2.txt. 1.txt ...
3
votes
3answers
181 views

Rearrange text file by prepending data rows with header row

I have a file whose content looks like this: 2009 150 0 0 0 0000 75.316 0.0400390625 0.00007 0.00000 0.8980 76.216 0.0400390625 0.00007 1.00000 0.9046 77.217 0.0400390625 ...
0
votes
2answers
80 views

Extracting with grep/sed a first pattern and then a second pattern that occured some lines before and related to the first

I'm trying to extract a specific line from a .htm file when a pattern occur ("Event 100" in my example below) but at the same time I need to retrieve also another pattern which is related to the first ...
3
votes
4answers
262 views

extract the characters before () using grep

I need to extract the characters before the character '('. My file structure is: rose(good)ook daisy()no lilly(bad)fine sunflower()nice I need output file as in the form of: rose ...
1
vote
1answer
65 views

Remove the string before the whitespace

I want to remove a word before the whitespace. My file structure is: ant tiger static rabbit lion dynamic monkey donkey I need the output as: ant tiger rabbit lion monkey donkey ...
1
vote
3answers
365 views

Extract part of string using grep

I have 3 files in a directory MYO144064T MYO144064TA MYO144064TX Where the digits and 11th character will change. In my csh script, I want to extract the letters 'A' and 'X' probably using grep ...
3
votes
4answers
144 views

Identifying genes from a list of genes

I have a gene list file. Some thing like this SWT21 SSA1 NRP1 EFB1 TFC3 MDM10 I have another file which also contains the names of these genes in my list along with other ...
2
votes
5answers
129 views

identifying words in file 1 and matching them to second file and printing them

I have two files as follows File 1 has list of Ids ram Tarah taikah jhdfklj File 2 has id=ram;*between*hkjhdswklf kjsdklhglshglkhgklsdgkhdfg id=taikah;jhdjfkhg**kjdfkjksfdjk ...
2
votes
4answers
1k views

Compare two text files and find matching lines

I have two files A and B. A looks like this (4 to 6 lines): GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT ...
0
votes
2answers
83 views

How to extract submatches from a string and write those to a file?

I want to parse a string for specific submatches and output those - one submatch per line - into a file. Essentially I would like to extract the value of each href-attribute: $ cat Fin <a ...
2
votes
3answers
304 views

How to show CPU time for processes via top without 'root' procs

Okay, So I've been attempting this for about three hours now without success. How do you search/display/use the top command (or ps command if it works...) to output a list of all procs, sorted by CPU ...
0
votes
4answers
75 views

What are alternative tools for searching files in full content?

I realized that most of the text related tools I use, grep/egrep/awk/sed are line-oriented. I guess that is a simplified approach to search in files but I was wondering if there is another set of ...
1
vote
2answers
126 views

comparing user given time for log file time

Apologies straight away for bad-styled-question-and-heading.....learning unix and its command these days, m trying to figure out a solution for below scenario : Lets say i have a log file which ...
1
vote
1answer
84 views

pcregrep fails due to segmentation fault

I am extracting the HTML source of a web page using the below command. curl http://www.linkedin.com/pub/ramesh-venkataraman/63/621/b42 -s | w3m -dump -T text/html > foo.txt The foo.txt has the ...
0
votes
3answers
422 views

Awk/grep/sed get comma separated list of numbers from lines of text

I have a log file that has lines that look like this: blah blah blah Photo for (702049679 - blah blah blah Now I know I could get all the lines like that from the file by doing: grep "Photo for" ...
1
vote
7answers
1k views

Sed / Awk - Find string exactly n characters long

Looking through the man pages for sed, awk and grep, I'm unable to find a way to search for a string that is exactly n characters long. Given the following text file, I want to extract just ...
2
votes
1answer
51 views

Matching two different lines that are at least N lines distant from each other

I would like to match files that contain try (in one line) and consecutive catch (in another line) at least N lines later (to find very long try-catches and try to get rid of them). I mean, the first ...
5
votes
5answers
444 views

Pattern matching across multiple lines

What is a quick and easy way to validate if the pattern "301 domaname.com 200" is present within BASH when spread across multiple lines of output? I was using something like the following: awk ...
1
vote
2answers
54 views

Replace “-from” with “this” in the begining of line

I want to replace "-from" with "this" in the begining of line. This should happen when that line has 'R' at the end and line above it has "D" at the end. For example for the block shown below: ...
2
votes
6answers
667 views

Remove lines that do not start with a pattern from a given set of patterns

I have a file that contains data like this: report aaaaaaaa - .. -th bbbbbbbbb -to ccccccccc .. --. Question: I want to remove any line that does not start with following strings : report ...
2
votes
1answer
89 views

replace text after match

aaaaaaaaa bbbbbbbbb -th ccccccccc_RD \ DDDDDDDD FFFFFFFF -th GGGGGGG_RD \ using sed/grep/awk etc, In the above text, if a line ends with "RD \" , replace "-th" with "-to" at the ...
1
vote
4answers
1k views

Using sed/awk to remove anything after first space

aaaaaaaa 09 bbbbbbbb 90 ccccccccccccccc 89 ddddd 09 Using sed/awk/replace, in the above text I want to remove anything that comes after the first space in each line. For example the output ...
3
votes
1answer
424 views

grep on line before the match plus the match

zzzzzzzzz aaaaaaaaa bbbbbbbbb & ccccccccc & ddddddddd hhhhhhhhh eeeeeeeee fffffffff & ggggggggg & in the above line, what i want is to grep/sed/awk (any method is fine) line that ...
4
votes
5answers
319 views

Multi-line grep beween two tags, only show the last match

I'm having a program that intermingles data segments into log output: log message log message ----BEGIN INLINE DATA---- data data data -----END INLINE DATA----- log messge I'm looking for something ...
4
votes
2answers
2k views

recursive search for a pattern, then for each match print out the specific SEQUENCE: line number, file name, and no file contents

What I am after is almost exactly the same as can be found here, but I want the format "line number, separator, filename, newline" in the results, thus displaying the line number at the beginning of ...
1
vote
1answer
196 views

How to use awk or sed to convert csv diffs into more readable format

Can anyone give me the example of how to use awk or sed (not sure which one, as I haven't use either of these much, as I have mostly been using grep and cut to work with csv data) to convert ...
12
votes
8answers
1k views

How to perform a multi line grep

How would you perform a grep for text that appears on two lines? For example: pbsnodes is a command I use that returns the utilization of a linux cluster root$ pbsnodes node1 state = free ...
1
vote
1answer
127 views

Retrieving two matches from repeated pattern

How can I retrieve matches from two repeated patterns: mappedname & its value in the text below?. MapName:abc someDiffName=someDiffValue x=3 y=6 NeedyMappedName=NeedyMappedValue . . Flag=true ...
6
votes
5answers
232 views

Get filesystem name and usage with `df -h`

df -h | grep test | sed -e 's/*%.^ //g;s/.*[ ^I]//' Output: /test /test/drv0 /test/drv1 df -h | grep test | cut -d '%' -f1 | sed -e 's/*%.^ //g;s/.*[ ^I]//' Output: 10 20 15 I want to ...
2
votes
4answers
155 views

AWK Search massive file and write to variable name

I want to pull data that I will need to reformat from a simulation file I am working with to prepare it as input for running other simulations. The target data is an optimized chemical z-matrix. The ...
10
votes
2answers
804 views

Script to quickly test all keyboard keys

I need to check some notebooks for bad keyboard keys, and so I'd like to speed that up as much as possible. I found nothing for this specific task, so my idea is a script that reads the pressed keys ...
10
votes
5answers
1k views

Using grep or awk

To capture a particular pattern, awk and grep can be used. Why should we use one over the other. How does this work in the background? Which is faster and why? E.g If I had a log file and I wanted ...
4
votes
1answer
318 views

grep: display filename once, then display context with line numbers

Our source code has error codes scattered throughout. Finding them is easy with grep, but I'd like a bash function find_code that I can execute (eg. find_code ####) which will provide output along ...
1
vote
3answers
143 views

Cat 2 files and avoid duplication of lines

I have the file1 with the following content {"name":"clio5", "value":"13"} {"name":"citroen_c4", "value":"23"} {"name":"citroen_c3", "value":"12"} {"name":"golf4", "value":"16"} {"name":"golf3", ...
0
votes
4answers
3k views

Extract substring using regular expression on a Unix file

I have file with below contents . /ABC/RTE/AD_900_VOP_123/OPP /ABC/RTE/TRE/AD_900_VOP_145/BBB /ABC/RTE/AN_900_VFP_124/FBF /ABC/RTE/HD_900_FOP_153/WEW /ABD/RDV/AD_900_VOP_123/OPP ...