1
vote
2answers
51 views

Print a line in stdout that matches an expression if the output contains another expression

This might be a common/easy task but I couldn't figure out from examples on the web or manuals of awk/sed/grep. So, here is the scenario: There is an internal command line tool that prints out a ...
1
vote
3answers
129 views

keep only certain part of a string in a certain column

I have a file like this: id target_id length eff_length 1 intron_FBgn0000721:20_FBgn0000721:18 1136 243.944268 1 intron_FBgn0000721:19_FBgn0000721:18 1122 ...
1
vote
2answers
55 views

How to match a number in one file to a name in another file?

Okay, I hope this is the right place to ask. I have 2 files. The first file has 4 fields: class CRN #, Instructor ID #, Class Section #, Number of Students. Example: 0002 T00005 006 15 0004 ...
1
vote
2answers
78 views

grepping for multiple items

I have about 6 items I need extracted from and LDAP base dump file fullName: uid: email: ... the colon is required for the search, mainly because uid appears in a number of places in the file but ...
0
votes
5answers
44 views

df -k + how to match the root volume line

please advise how to match the "/" volume from df -k command? I tried the following: [root@machine /]# df -k | grep "/" /dev/vx/dsk/bootdg/rootvol 130926685 71378710 58238709 56% / /devices ...
0
votes
1answer
50 views

Finding words with one vowel group

I am trying to use a command to find all words in a list of words with one group vowels. Like four, for and far, but also words like ore and or. What I got so far: grep -i ...
2
votes
4answers
142 views

Remove all comments from a file?

I have a file with a few lines commented out: foo bar stuff #Do not show this... morestuff evenmorestuff#Or this I just want to print all the uncommented code: foo bar stuff morestuff ...
-1
votes
1answer
57 views

Match and combine records in Bash [duplicate]

Consider two csv files: $ cat given.csv 123,John 246,Paul 369,George 987,Ringo $ cat family.csv 246,McCartney 123,Lennon 987,Starr 369,Harrison Note that the lines are not ordered! How might I use ...
2
votes
2answers
34 views

Gather job usage information on cluster

I am running simulations on a linux cluster shared by hundreds of other users. There is a job scheduler installed on the cluster that determines who runs where, and one of the scheduler commands ...
1
vote
4answers
60 views

Parsing complex text file using Unix commands

I have the following text structure which I would like to parse: >Cluster 423 0 56aa, >HWI-ST1448:257:C3V2HACXX:1:1106:19087:2550.1... at 92.86% 1 64aa, ...
2
votes
2answers
59 views

Use awk to find first occurrence

I have a log file that gets updated when my script runs. The script will insert "Start of script" text when it starts and "End of script" text when it finishes running. I am trying to capture the ...
4
votes
4answers
161 views

extract lines according to a particular column

I have a CSV file like CK,ck XYZ,xyz,xyzs ABC,abc,abcs PQR,pqr,pqrs LMN,lmn, IJK,ijk, I have to check if something is written in column 3 except whitespace, then display the whole line.the output ...
-1
votes
2answers
39 views

Searching out a pattern from Logs

The format of the logs is in this manner: Junk Junk Junk : Junk Junk Junk:IP/Port Junk Junk I want to search using the IP and the output should be only the IP/Port part of each line in that log ...
2
votes
4answers
274 views

Only cat from specific line X (with a pattern) to other specific line Y (with a pattern)

A little extended problem from "cat line x to line y on a huge file": I have a huge file (2-3 GB). I'd like to cat/print only from the line having "foo:" to the line having "goo:". Assume that "foo:" ...
1
vote
2answers
64 views

grep contents of files based on a list of files

Running CentOS 6.5, qemu-kvm. I have a script which builds a list of running VM's. I want to pull information from those .xml files of only the VM's that are running. cat /dev/null > ...
3
votes
4answers
102 views

How to remove text matching specific patterns from a file

I want to compare two files to check for differences between them, fileA and fileB. fileA is like a template file and fileB is the file which I want to compare to it. Anytime I find a difference I ...
2
votes
1answer
31 views

Get each column which contains multiple spaces?

My file: subnet 172.25.10.0 netmask 255.255.255.0 { option domain-name-servers 172.25.10.9, 8.8.8.8; default-lease-time 300; max-lease-time 7500; range dynamic-bootp 172.25.10.10 172.25.10.30 ; ...
-3
votes
2answers
128 views

Extract certain column from CSV files [closed]

I have a directory with a group of CSV files. All files have the same column headers. I need to extract values in a certain column from all files. The common part in files names is ...
5
votes
4answers
222 views

How to replace m part of Lines with n part of Lines?

I have a file "test" like this: RewiteEngine On RewriteCond %{REMOTE_ADDR} !^192\.168\.1\.7$ [NC] RewriteCond %{REMOTE_ADDR} !^192\.168\.1\.8$ [NC] RewriteCond %{REMOTE_ADDR} ...
32
votes
4answers
2k views

Reverse grepping

Let's say, I have a really big text file (about 10.000.000 lines). I need to grep it from the end and save result to a file. What's the most efficient way to accomplish task?
5
votes
2answers
125 views

Is there a way to make this one-liner faster?

Context I have a directory of thousands of zip files that are dated in the form YYYYMMDD_hhmmss.zip and each about 300K. Within each zip file is about 400 xml files each about 3K. The problem I ...
6
votes
5answers
239 views

Strategy to extract movies's name from this ununiform dataset?

I am working on a movie database problem to improve regular expressions, this is the problem I'm running into. My dataset looks like this: Movie Name (variable space and tabs) year Movie1(can ...
5
votes
2answers
101 views

Grepping for a block of text with parts that can be optional

I have multiple entries that describes an event in a very large log file, say A.log. I would like to do two things with the event entries in the log file: Count the number of occurrences of each ...
1
vote
4answers
115 views

Printing a new line using awk

I have a load of files in which I need to take out specific rows and then put the data I've taken out into a spreadsheet. An example would be my file shows: Name: w Age: x Height: y Weight: z I ...
1
vote
2answers
432 views

Extract Values from simple html file via grep/awk

I have another grep/awk/sed issue within the attached HTML code below. Given is a simple HTML file with table inside. The HTML is generated by a smart meter (household energy meter). Inside the html ...
6
votes
8answers
927 views

Grep rest of line…after match

I have a file containing only two lines, with the following structure: $ cat /tmp/pwpower.log 000D6F0000D34227, -114.10 000D6F0001A405C4, -130.09 The values are power values of my solar plant. ...
2
votes
3answers
689 views

GREP / SED or AWK: Print entire paragraph in a file on pattern match

I have a file with hundreds of paragraphs of around 15 lines each. I need to search for a pattern, say Occurance: 1. If this pattern is found in the para, I need to print the entire paragraph. Note ...
3
votes
3answers
205 views

How can I get the first column of a 300GB txt file?

let me first explain my problem in detail. It's actually pretty simple. I have a huge .txt file, 300GB to be more preciese, and I would like to put all the distinct strings from the first column, that ...
8
votes
3answers
2k views

What are the exact differences between awk and cut with grep? [closed]

We know that we can get the second column of the line we want from a file using these two techniques: awk '/WORD/ { print $2 }' filename or grep WORD filename| cut -f 2 -d ' ' My questions are: ...
0
votes
4answers
304 views

Search for a Value only in one column w.o using awk, sed, or perl

I have a file that looks like this : Marketing Ranjit Singh FULLEagles Dean Johnson Marketing Ken Whillans FULLEagles Karen Thompson Sales Peter RobertsonPARTGolden ...
0
votes
1answer
100 views

Duplicate specific text in text file, using perl or grep

I need to duplicate part of a plain text file as follows: The text file consists of a sequence of "pages", of the form: <page [lots of lines of text] /page> <page [lots of ...
3
votes
2answers
85 views

how to grep complex hierarcy?

I have a file as:- start apple 1 a 2 b 3 c start orange 4 a 5 b start mango 1 a start a/b/c 5 z end 4 b end 6 c end start banana 3 c end 4 d 5 e end I want the output as :- 1 apple/a 2 apple/b 3 ...
1
vote
2answers
73 views

Parse,Manipulate Data In linux/Unix

I want to have exactly the same output in this post(http://unix.stackexchange.com/questions/126139/extract-data-in-linux-unix)as above,but I have a new input file,which is below: ABCB11 4 ACE 11 ...
1
vote
2answers
174 views

Extract data in linux/unix

I have input data which I want to parse and extract values using awk/grep/sed: group-2 9 10 text color=black,from=ABCB11,fromid=4,order=2,thickness=3,to=ACE,toid=11,use=1,z=1 group-3 0 1 text ...
2
votes
1answer
364 views

Regex doesn't work with grep

I have a string like this TEST="/dev/sda1 on /media/sda1 type vfat (rw,relatime,fmask=0000,dmask=0000,allow_utime=0022,codepage=cp437,iocharset=iso8859-1,quiet)" (Result from mount | grep sda1) ...
0
votes
2answers
423 views

Compare first column in different files

I want to compare one file with other files in the same directory. file1.txt contains: move 34#123# get 11#278 put 33#29#567#23 file1.txt should compare with files 1.txt and 2.txt. 1.txt ...
3
votes
3answers
230 views

Rearrange text file by prepending data rows with header row

I have a file whose content looks like this: 2009 150 0 0 0 0000 75.316 0.0400390625 0.00007 0.00000 0.8980 76.216 0.0400390625 0.00007 1.00000 0.9046 77.217 0.0400390625 ...
0
votes
2answers
129 views

Extracting with grep/sed a first pattern and then a second pattern that occured some lines before and related to the first

I'm trying to extract a specific line from a .htm file when a pattern occur ("Event 100" in my example below) but at the same time I need to retrieve also another pattern which is related to the first ...
3
votes
4answers
345 views

extract the characters before () using grep

I need to extract the characters before the character '('. My file structure is: rose(good)ook daisy()no lilly(bad)fine sunflower()nice I need output file as in the form of: rose ...
1
vote
1answer
69 views

Remove the string before the whitespace

I want to remove a word before the whitespace. My file structure is: ant tiger static rabbit lion dynamic monkey donkey I need the output as: ant tiger rabbit lion monkey donkey ...
1
vote
3answers
1k views

Extract part of string using grep

I have 3 files in a directory MYO144064T MYO144064TA MYO144064TX Where the digits and 11th character will change. In my csh script, I want to extract the letters 'A' and 'X' probably using grep ...
3
votes
4answers
167 views

Identifying genes from a list of genes

I have a gene list file. Some thing like this SWT21 SSA1 NRP1 EFB1 TFC3 MDM10 I have another file which also contains the names of these genes in my list along with other ...
2
votes
5answers
161 views

identifying words in file 1 and matching them to second file and printing them

I have two files as follows File 1 has list of Ids ram Tarah taikah jhdfklj File 2 has id=ram;*between*hkjhdswklf kjsdklhglshglkhgklsdgkhdfg id=taikah;jhdjfkhg**kjdfkjksfdjk ...
3
votes
4answers
3k views

Compare two text files and find matching lines

I have two files A and B. A looks like this (4 to 6 lines): GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT ...
0
votes
2answers
106 views

How to extract submatches from a string and write those to a file?

I want to parse a string for specific submatches and output those - one submatch per line - into a file. Essentially I would like to extract the value of each href-attribute: $ cat Fin <a ...
2
votes
3answers
799 views

How to show CPU time for processes via top without 'root' procs

Okay, So I've been attempting this for about three hours now without success. How do you search/display/use the top command (or ps command if it works...) to output a list of all procs, sorted by CPU ...
0
votes
4answers
89 views

What are alternative tools for searching files in full content?

I realized that most of the text related tools I use, grep/egrep/awk/sed are line-oriented. I guess that is a simplified approach to search in files but I was wondering if there is another set of ...
1
vote
2answers
200 views

comparing user given time for log file time

Apologies straight away for bad-styled-question-and-heading.....learning unix and its command these days, m trying to figure out a solution for below scenario : Lets say i have a log file which ...
1
vote
1answer
121 views

pcregrep fails due to segmentation fault

I am extracting the HTML source of a web page using the below command. curl http://www.linkedin.com/pub/ramesh-venkataraman/63/621/b42 -s | w3m -dump -T text/html > foo.txt The foo.txt has the ...
0
votes
3answers
601 views

Awk/grep/sed get comma separated list of numbers from lines of text

I have a log file that has lines that look like this: blah blah blah Photo for (702049679 - blah blah blah Now I know I could get all the lines like that from the file by doing: grep "Photo for" ...