The command-line is the interactive interface to your shell.

learn more… | top users | synonyms (1)

2
votes
2answers
79 views

How can I CTRL^C out of a password prompt?

Say I started a su command, and I want to cancel it. Control+C doesn't work for su like it does for sudo... I have to finish the prompt (either by getting the password wrong enough times or by ...
0
votes
2answers
30 views

How to know which servers are connected to my unix system or user? [on hold]

How to know which servers are connected to my UNIX system or user? What I mean is that after I have logged in with my user name, I want to know which servers are connected to this user otherwise if I ...
0
votes
0answers
17 views

when rlwrap installation facing below error [on hold]

When I am installing rlwrap in Linux RHEL, I am getting below error, make: *** No targets specified and no makefile found. Stop Kindly help me to install rlwrap.
2
votes
2answers
120 views

How do I double each line of piped output? [duplicate]

How do I double each line of input piped in? Example: echo "foobar" | MYSTERY_COMMAND foobar foobar
4
votes
2answers
152 views

Why does tmux fail to “scroll” when entering a command that exceeds one line? (OSX Terminal.app)

When I use tmux and enter a command that exceeds the line, it fails to redraw the previous line. It simply clears the current line and I can't see what I just wrote. It does only redraw the first ...
-1
votes
0answers
57 views

How do I delete everything on my computer with one command using bash? [on hold]

I'm trying to delete every single file and directory on my computer. How do I do so?
8
votes
6answers
4k views

Read out pulseaudio volume from commandline? (I want: “pactl GET-sink-volume”)

I want to read out the volume level I can set with pactl set-sink-volume $SINK $VOLUME Is there an easy way to do that? As easy as the hypothetical pactl get-sink-volume $SINK ? (What I'm ...
137
votes
11answers
118k views

How can I close a terminal without killing the command running in it?

Sometimes I want to start a process and forget about it. If I start it from the command line, like this: redshift I can't close the terminal, or it will kill the process. Can I run a command in ...
1
vote
2answers
2k views

How to get sound intensity of an audio input through terminal?

I want to know the intensity of the sound being heard by an audio in source like a mic or Line-in through Command line. Kinda like the progressbar under the mouse but in CLI. audiointensity mic0 10 ...
0
votes
2answers
35 views

How to burn an iso image from the command line

Is that possible to get an alternative to the command dd to burn an iso image including some options: Detect the burning device , Burn an iso image and eject the CD from the command line?
9
votes
2answers
8k views

How can I install ncdu on Red Hat?

The answers provided to this question doesn't help. I'ved tried yum install ncdu But I'm getting No package ncdu available
15
votes
12answers
7k views

Console Text Editor with Windows-like keyboard shortcuts (ctrl-z, x, c, v)

Ok, I realise that I risk a religious war asking a question about text editors, but here goes. Requirements Mostly used for config file edits Text based not GUI Available for Raspian flavour of ...
1
vote
0answers
16 views

How do I set up user quota for /var/www?

I want to add quota per user in my Apache2 webroot. My /var/www directory is not a partition. I've found tutorials on how to set up quota for partitions, but how do I set up /etc/fstab without moving ...
2
votes
1answer
62 views

How to delete files with ~?

I have removed all my python code from the home directory, but when I do ls I get: a11.py~ class1.pdf foobar.txt~ n1 pic.py~ When I do ls like this: ls *.py I get: ls: cannot access *.py: No ...
16
votes
4answers
2k views

How to run a command at an average of 5 times per second?

I have a command-line script that performs an API call and updates a database with the results. I have a limit of 5 API calls per second with the API provider. The script takes more than 0.2 seconds ...
1
vote
1answer
23 views

How to run a process and find how much memory it uses? [duplicate]

I regularly use time to find out how long a process takes. Is there an equivalent command for memory? The usual ways to find out how much memory a process takes (ps,/proc/meminfo, etc.) work fine for ...
0
votes
2answers
44 views

return first instance of characters from a list

Lets say I have the output of this command saved to a file. cat /dev/urandom | tr -dc '[:graph:]' | fold -w 1000 | perl -pe 's/(.)(?=.*?\1)//g' | head -n 50 I would like to compare only the first n ...
5
votes
3answers
6k views

How to permanently enable scl CentOS 6.4?

I installed a newer version of devtoolset (1.1) and was wondering how I would go about permanently setting these to be default. Right now, when I ssh into my server running CentOS, I have to run this ...
15
votes
4answers
1k views

How can I see the whole file and also wait for more data to be added to that file?

I want to read whole file and make it waiting for input, just like tail -f but with the complete file displayed. The length of this file will always change, because this is a .log file. How can I ...
2
votes
1answer
22 views

Debian : Installing Coturn causing error, and package not getting removed.

I am working on install Coturn which is an open-source Stun and TURN server. For that, I had two options, one was to download the debian package and install it by gdebi, and other was to make the ...
45
votes
2answers
38k views

How to suspend and resume processes

In the bash terminal I can hit Control+Z to suspend any running process... then I can type fg to resume the process. Is it possible to suspend a process if I only have it's PID? And if so, what ...
31
votes
7answers
4k views

How do I create a blank PDF from the command line?

I recently needed a single blank PDF page (8.5" x 11" size) and realized that I didn't know how to make one from the command line. Issuing touch blank.pdf produces an empty PDF file. Is there a ...
1
vote
2answers
69 views

Bash commands not found

I use CentOS 7 and I install anaconda and some tools, after that some basic command like clear which not work. [zhilevan@localhost ~]$ clear bash: clear: command not found... when I echo $PATH I ...
0
votes
1answer
29 views

Can all of fork(), exec() and system() be wrong? [closed]

I understand why it could be less than best practice if I write C code that executes shell commands by calling system() and that it's better to use exec and fork but then a very experienced C ...
0
votes
1answer
32 views

How to use ClamAV to scan the memory

How can I only scan the computer RAM for viruses using the ClamAV command clamscan? I already tried, because I found it on ClamWin forum: clamscan --memory But it seems, that the Linux version ...
0
votes
2answers
45 views

What can cause my shell to look like this? [duplicate]

I'm currently developing a home automation framework for my apartment. This involves getting JSON over Serial from an Arduino. When the JSON can't be parsed (usually only on startup) I log it as an ...
2
votes
3answers
37 views

Is there a way to see the dimensions of a jpeg file in linux using the command line?

I have some .jpeg images saved in a file in a cluster at school. I am at home using PuTTY to access one of the Debian nodes. I'm able to get to the folder with all the images but I need to see the ...
1
vote
2answers
37 views

how to move set of files in one-liner [duplicate]

I wanted to move 1000 files in a directory to another dir. I can do it if I'm in the original dir but if I try this mv $(ls /home/jeremy/source|tail -1000) /home/jeremy/dest from elsewhere, the ...
9
votes
4answers
15k views

Command Line Tool for monitoring Java Heap

Is there any command line tool for monitoring the heap size usage of Java in CentOS?
0
votes
1answer
52 views

What is the meaning of xargs show limits output

You can use xargs to discover limits about the commandline you're using: $ xargs --show-limits Your environment variables take up 1901 bytes POSIX upper limit on argument length (this system): ...
1
vote
1answer
19 views

Trying to copy/paste long script with multiple EOFs, Terminal starts running half-way through

Was trying to create a text block that I could just copy and paste into a Terminal window to accomplish something (in this case, create a systemd script to do maintenance on MySQL dbs, create a timer ...
0
votes
3answers
22 views

How to apply dos2unix recursively to all the contents of a folder?

Is there a way to apply the dos2unix command so that it runs against all of the files in a folder and it's subfolders? man dos2unix doesn't show any -r or similar options that would make this ...
10
votes
2answers
3k views

Check ping statistics without stopping

Is there a way to tell ping to show its usual termination statistics without stopping the execution? For instance, I'd like to quickly view: --- 8.8.8.8 ping statistics --- 2410 packets transmitted, ...
7
votes
6answers
3k views

How to grep-inverse-match and exclude “before” and “after” lines

Consider a text file with the following entries: aaa bbb ccc ddd eee fff ggg hhh iii Given a pattern (e.g. fff), I would like to grep the file above to get in the output: all_lines except ...
1
vote
2answers
44 views

How to find all files in /etc beginning with P

I would like to know how to find all files in the /etc file beginning with P, which I will then store the results of in a new file. So far I have $find /etc -name Unsure of what comes next.
5
votes
2answers
894 views

Why does Bash history not record this command?

The command printf "#!/bin/bash\n" > t generates an error(bash: !/bin/bash\n": event not found), but hitting the up key does not recall the command so that I can modify it. Why is that? (What I ...
1
vote
0answers
22 views

How to use xpra like xvfb-run?

xvfb-run allows me to open a display and run a graphical app and when the app finishes xvfb closes too. for example xvfb-run --auto-servernum --server-args="-screen 0, 1920x1080x24" nw script.js ...
2
votes
1answer
2k views

Unable to install SciPy

I need to use the module skimage, which calls the module SciPy (I need to find contours) import numpy from sys import argv from PIL import Image from skimage import measure # Inicialization ...
2
votes
1answer
94 views

Updatedb unrecognized option '--localpaths='

I am attempting to update a single directory I created. I'm using updatedb so it will be found by the locate command. Command used: updatedb ...
3
votes
1answer
181 views

How can I change the error messages for 'touch'?

Lets just have some typical usage of touch as expected: $ touch this $ sudo chown root this $ touch this touch: this: Permission denied Now what I want to do is change touch: this: Permission ...
70
votes
14answers
38k views

How to grep a specific line _and_ the first line of a file?

Assuming a simple grep such as: $ psa aux | grep someApp 1000 11634 51.2 0.1 32824 9112 pts/1 SN+ 13:24 7:49 someApp This provides much information, but as the first line of the ps ...
2
votes
2answers
48 views

Shrinking Raspberry Pi SD .img via Ubuntu Server (cli)

I installed Raspbian to a 16 GB card and expanded the filesystem. When I made a dd backup of the card, the .img file output was ~16 GB. Most of it is unused space in the ext4 partition—I'm only using ...
0
votes
1answer
51 views

Only one line break in fasta file

I have a fasta file like: grep -A 7 -B 4 COSN229024 wrong.fasta: >COSN9627597 CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA >COSN8175610 CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT >COSN229024 ...
-2
votes
2answers
55 views

standard deviation using awk [closed]

I am using below command to get standard deviation of file A names 1 2 3 avg 23.3107 20.0372 21.7236 21.6905 awk '{x[NR]=$0 ;} END{a=$4; for (i in x){ss += ...
19
votes
4answers
16k views

How can I run a specific command for each find result?

How would one run a specific command for each file that was found by using the find command? For the purpose of the question lets say that I would simply like to delete each file found by find. I am ...
3
votes
2answers
59 views

Basic network via command line

I am using Fedora 23. Using the file explorer I "found" this page It shows where I can access other networks, I can click on them, and log in... My questions is: Is there an equivalent place ...
50
votes
12answers
118k views

How can I get a count of files in a directory using the command line?

I have a directory with a large number of files. I don't see a ls switch to provide the count. Is there some command line magic to get a count of files?
1
vote
1answer
43 views

Terminal color usage does not stay

I was wondering if any of you knew why doesn't my terminal keep displaying stuff colored, after I use the command ls -l -a --color=always I would like it to stay colored, so when the next time I type ...
31
votes
8answers
15k views

How do I split a flac with a cue?

I've got a full album flac, and a cue file for it. How can I split this into a flac per track. I'm a KDE user, so I would prefer a KDE/QT way, I would like to see command line and other gui answer's ...
0
votes
4answers
64 views

grep all strings that start with a certain char, and finish with another char

I need to grep all strings that start with "[" and finish with a certain string, e.g. "apal". So all chars in between these 2 chars would be shown as well. Given an input such as: ...