The command-line is the interactive interface to your shell.

learn more… | top users | synonyms (1)

0
votes
1answer
97 views

Ubuntu x86 10.10 terminal

I just downloaded a Ubuntu v10.10 vmware image for Windows. I'm trying to install a web application that can only run on Linux MySQL, Apache and PHP. How do I open a terminal in Ubuntu?
0
votes
5answers
49 views

Return one value and save it into a variable

I have this sentence that returns two values. cat /ora$sid/dbs/listener.ora|grep PORT|sed 's/.*PORT.*\([0-9]\{4\}\)\(.*\)/\1/' Return 1521 1522 With this sentence I want to get only one value. ...
0
votes
3answers
38 views

How to run a program in background and also using && to execute another command [closed]

I want to run my node app in background and curl simultaneously using && .I tried following but not work node app.js &;curl localhost and i tried another one node app.js & &&...
0
votes
1answer
38 views

Explain the output of realpath [closed]

I am trying to use the command line to return the absolute path to a file. I read that there are multiple ways to go about this, namely the realpath, readpath -f, and locate commands. None of these ...
0
votes
1answer
28 views

Why am I receiving the error: “sudo: update_prebinding: command not found” on the command line?

One of my applications won't open so I'm trying the first thing to do on this website: http://www.cnet.com/news/tutorial-what-to-do-when-a-mac-os-x-application-will-not-launch/ But I am getting an ...
0
votes
1answer
35 views

FFMpeg : Creating a video clip of approx. 10 seconds when video duration is unknown without audio-

I am working on a project where I am looking to extract a video clip from an input video. I have found many links(Eg : link) which do this task, but in all this I have to specify video duration. ...
0
votes
1answer
68 views

How to write bash script while using command as condition in if statement?

I am writing a bash script to process input from html form. I have two issues which I can't seem to be able to figure out. I am a beginner to Unix. First problem is that I can't get my if statement ...
0
votes
1answer
35 views

Can all of fork(), exec() and system() be wrong? [closed]

I understand why it could be less than best practice if I write C code that executes shell commands by calling system() and that it's better to use exec and fork but then a very experienced C ...
0
votes
1answer
74 views

What is the meaning of xargs show limits output

You can use xargs to discover limits about the commandline you're using: $ xargs --show-limits Your environment variables take up 1901 bytes POSIX upper limit on argument length (this system): ...
0
votes
1answer
57 views

Only one line break in fasta file

I have a fasta file like: grep -A 7 -B 4 COSN229024 wrong.fasta: >COSN9627597 CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA >COSN8175610 CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT >COSN229024 ...
0
votes
1answer
37 views

(ls) command won't show exact size - Weird output [closed]

I am trying to find the size of the files on my hard drive in exact bytes, but whenever the size gets too big the number turns all weird (like 1.98329e+12). Can I stop it from doing this or convert ...
0
votes
1answer
47 views

Column comparison using awk [duplicate]

I would like to compare the first column of file1 with the second column of file2 and only if they match it should display any matching lines in file2 only as the output. The columns are separated by |...
0
votes
1answer
42 views

How to force an application to use a specific cpu? [duplicate]

For example : To build a kernel we can use make it will take more than one hour , to accelerate the process we can use make -j4 all this may finish almost four times as quickly. Generally : How to ...
0
votes
1answer
46 views

Unable to detach a USB device on Ubuntu 14.04

I was using udisks to unmount and detach usb device with following commands which works just fine on Ubuntu 10.04 udisks --unmount /dev/sdb1 udisks --detach /dev/sdb Because udisks is not available ...
0
votes
3answers
303 views

Help with tr command

Assume that the file ft has 25 lines of text. Explain the command: tail -15 ft | tr "a" "A" > ft and tell me how many lines the file ft has after the execution of the command. I understand that ...
0
votes
1answer
28 views

copy a directory into multiple directories

I have structure like A directory dir_a/dir_b and dir_c/dir_d to dir_z or some other 100 names. now I need to copy dir_b into dir_d and all other sub-directories in dir_c. And a part from that every-...
0
votes
1answer
71 views

How can I succesfully call the execv function? [closed]

I am trying to make a program that will copy file1 into file2 the following way: cp -i -p file1 file2 Now I call my executable copy and so by calling copy file1 file2 It will do the same thing ...
0
votes
1answer
60 views

Solaris: Spooling filesystem is full

I have a Solaris 5.8 machine that will no longer print. print job that come from the terminal say: "See if spooling file system is full" I had a look around /var/spool but it isn’t particularly ...
0
votes
1answer
203 views

Read columns from file into separate variables

I need to read the following input into separate columns as variables? input.txt b73_chr10 w22_chr9 w22_chr7 w22_chr10 w22_chr8 w22_chr6 I have written the following command;but I guess it ...
0
votes
1answer
125 views

Split string into array and print each element on a new line with commandline

I'm having a String which is seperated by commas like a,b,c,d,e,f that I want to split into an array with the comma as seperator. Then I want to print each element on a new line. The problem I'm ...
0
votes
1answer
33 views

Possible to prevent multitail from closing “finished” command windows?

Assume a multitail call like the following: multitail -s 2 -l "long-running-command" -l "short-running-command" Now, I would like to have both windows remain open, even after they are finished. ...
0
votes
2answers
43 views

usermod question about option e

after reading the man pages I am unable to find an explanation of what this does (the tack e option) usermod -L -e 1 username -e 1 does this mean one day after the linux epoch, jan 1 1970? How ...
0
votes
1answer
52 views

grep for numbers over 10

I'm looking through a file for specific kernels. I want everything from 3.8. to 3.17. egrep 3.[8-17] is kind of the thing I want but that obviously doesn't work. How do I grep using the example ...
0
votes
1answer
28 views

Why is echo not working for mt valgrind command?

So I have my makefile working great, except that It doesn't create the valgrind.out file and I don't know why. So the console succesfully prints out that my executable file line is created but not ...
0
votes
2answers
291 views

APT repositories on Android

I am using a terminal emulator on Android called "Termux". It comes with the APT command installed. However, the repository is very limited. What I want to do, is to see if larger repositories like ...
0
votes
1answer
24 views

What the long option “ --debug” suppose to do in bash?

GNU bash, version 4.3.42(2)-release-(i686-pc-msys) Usage: bash [GNU long option] [option] ... bash [GNU long option] [option] script-file ... GNU long options: --debug --...
0
votes
1answer
63 views

Thunar custom action: Extraction to subdirectories

I am attempting to create a Custom Action in Thunar (File Manager) that will extract a gzip archive into a subdirectory of the same name (e.g. abc.tar.gz to abc/). I created this command, which works, ...
0
votes
1answer
244 views

Re-encoding video with ffmpeg including all subtitles but not all audio

I'm trying to re-encode video streams from a Matroska file to save space, while keeping all the subtitles as-is, using ffmpeg. I want to write a generic command that works without me having to specify ...
0
votes
1answer
44 views

Splitting a flac from a cuesheet metadata block

Some flac files apparently have a “cuesheet metadata block”. I know how to split flacs files with shnsplit when I have a separate cuesheet at hand (cf. “How do I split a flac with a cue?”), but how do ...
0
votes
1answer
135 views

How do I run a command on startup?

I need to run the same command every time I boot. I'm running Linux Mint 17.2 Cinnamon. I have added a startup application with the command under preferences "startup applications". However the ...
0
votes
1answer
22 views

Lock multiple files in a shell script

I have a C program that can lock 1 file. I need to lock multiple files so the solution here would be to have multiple instances of this program running but this also means having multiple terminals ...
0
votes
1answer
37 views

browse local S3 storage (not Amazon) with command line tool

I wish to browse, put and get files in local S3 storage from vendor EMC Atmos Cloud Storage I have a RHEL7 and wish to do it on command line. We have no flat structure (like Amazon) we use ...
0
votes
1answer
311 views

Copy all files matching criteria on find command with -exec

Below are my attempts at copying all files except .out and .class files into a subdirectory titled homework21/. Note homework21 is a subdirectory of the folder in which I am working in. me@ice4:~/...
0
votes
1answer
71 views

Languages to use for console tools - Go, Rust, Javascript? [closed]

I'm planning to write a data cruncher command line tool, I'm considering Go, Rust and Javascript. But I'm afraid of jeopardising the project by using something not stable enough or painful to deploy. ...
0
votes
1answer
132 views

Prompt user to enter for his/her user password to execute non sudo terminal command [closed]

As the question asks I want to learn how to prompt users' password for nonsudo commands EDIT: I think that I could not tell it clearly according to comments, so I will elaborate my request with ...
0
votes
1answer
58 views

How to install Blender in a version of your choice using the command line?

I have Blender 2.69, this is the version I got when I typed sudo apt-get install Blender in the command line. I do not know if this version is stable, but maybe it is the reason why a part of ...
0
votes
1answer
33 views

How to remove Blender in the command line ?

I tried to remove Blender in the command line , in order to install it anew because of flawed selection in edit mode. So, this is what I typed and the error message I got, I do not understand the ...
0
votes
1answer
58 views

Split a set of data to massives and find maximum for each

I have a set of data looking like this: 1 0.1 2 0.23 3 0.05 5 0.73 6 0.40 7 0.34 10 0.11 11 0.45 12 0.68 I need to split the set of data to massives using the rule that the next ...
0
votes
1answer
25 views

Production ready derivative from LFS

I've recently started delving into LFS and have been wondering if there are any popular or well-used distros that have been derived from LFS or BLFS. There are a few of completed projects on Github ...
0
votes
2answers
70 views

What is the command in linux, or a utility to know the current comand status (process status)

For example when I write telnet abc.wtf the telnet session begins saying trying to connect so and so IP, but is there a command that I can type in and know what is the current process happening to ...
0
votes
3answers
71 views

print last line of !! command

so I want to be able to print helloworld using the !! command. I tried creating a text file with the text helloworld on it. Then I say cat textFileName It prints helloworld. Then I say !! and it ...
0
votes
1answer
34 views

extract subfolders outside and rename if necessary

I have a directory looks like: dhcp-18-189-47-44:CE-06-new-stuctures_backup wenxuanhuang$ ls DFT-00001 DFT-00004 DFT-00007 DFT-00010 DFT-00013 DFT-00016 DFT-00019 DFT-00022 DFT-00025 DFT-00028 DFT-...
0
votes
1answer
235 views

How to find what the “Mate version” of programs are called

On Mate systems, many programs correspond to (and are sometimes forks of) other programs with more well-known names: nautilus -> caja gnome-terminal -> mate-terminal ark -> engrampa gedit -> pluma ...
0
votes
1answer
62 views

How to run bunch of hierarchical dummy shell processes (process of another process, etc.)?

I would like to run multiple processes where each process is running another one, so it will create a long process branch. I've tried: $ bash -c '(bash -c "sleep 20"); sleep 20' & $ pstree $(...
0
votes
2answers
62 views

How can I convert 14/Jul/2015 into 14-08-2015 [duplicate]

How can I convert 14/Jul/2015 into 14-08-2015? It is saying invalid date format because of the Jul element, but if I put 07 then it works fine. I have tried this: echo "Please enter the date: " ...
0
votes
2answers
157 views

Display CPU cores usage in percentage without using top

I am using java to run a command on linux. Since top is an interactive command and need to press 1 to get the info of all the cpu(s) so I cannot use that. So I am using the following command to get ...
0
votes
3answers
69 views

Delete all files that DON'T have duplicate names?

Given a large list of files, containing the following: FILE1.doc FILE1.pdf FILE2.doc FILE3.doc FILE3.pdf FILE4.doc Is there a terminal command that would allow me to remove all files that do not ...
0
votes
2answers
2k views

USB Disk Read-only, cannot format - Turn off write-protection

I have a USB disk which does not allow me to format/mount/unmount or created partitions on it. Using dmesg | tail gives me the following result: I found this post on AskUbuntu and tried using ...
0
votes
1answer
252 views

Open a webpage and enter a username and password via CLI

Ultimately, I want to use a bash script to automatically open and log into a website. I was wondering if I could use the curl or elinks commands to log in to a website and then somehow export that ...
0
votes
2answers
272 views

How do I add Metasploit into my PATH variable?

I have Metasploit installed on my Mac in /usr/local/share/msf. Everytime I want to use it I have to cd into that directory and use msfconsole. If I try to /usr/local/share/msf/msfconsole in my home ...