The command-line is the interactive interface to your shell.

learn more… | top users | synonyms (1)

0
votes
1answer
27 views

Why am I receiving the error: “sudo: update_prebinding: command not found” on the command line?

One of my applications won't open so I'm trying the first thing to do on this website: http://www.cnet.com/news/tutorial-what-to-do-when-a-mac-os-x-application-will-not-launch/ But I am getting an ...
3
votes
1answer
39 views

groupadd -p Not Recommended?

I have a question about groupadd, specifically with password (-p). It says it is not recommended, "This option is not recommended because the password (or encrypted password) will be visible by users ...
0
votes
1answer
33 views

FFMpeg : Creating a video clip of approx. 10 seconds when video duration is unknown without audio-

I am working on a project where I am looking to extract a video clip from an input video. I have found many links(Eg : link) which do this task, but in all this I have to specify video duration. ...
1
vote
1answer
56 views

Command works, and then doesn't (cd/ls)

I'm currently doing my thesis and thus working on a school server. And unfortunately, I'm struggling with even the most basic concepts. Such as this. I have a directory /home/myname/Data If I'm in /...
0
votes
1answer
68 views

How to write bash script while using command as condition in if statement?

I am writing a bash script to process input from html form. I have two issues which I can't seem to be able to figure out. I am a beginner to Unix. First problem is that I can't get my if statement ...
2
votes
1answer
32 views

Improve existing alias to dynamically replace command line text

I have an alias in .bashrc like this: alias ylog = "yarn logs -applicationId" This works well when I do ylog application_123. Sometimes, my job names come in the form of job_123 instead of ...
1
vote
3answers
74 views

How can I print a section of a manual (man)?

From command line, how can I do in order to show a specific section of the result of man something? For example, if I wanted to get some information about the return value of C function write, I'd ...
1
vote
1answer
32 views

Is there an additional option to display hidden command on the terminal?

Copy and pasting from a website to the terminal is very harmful , there are an example here You past the following line :ls /some/thing/much/too/long/to/type/ , by pressing Enter the following ...
1
vote
1answer
59 views

Command line tool for easy multiline regex search and replace

I use PCRE regular expressions for search and replace very often when working with a text editor and I was left quite unhappy after I found out that in powerful Unix command line tools like perl, awk ...
1
vote
1answer
47 views

Can't run multiple files with nohup

This is what which is happening [4]+ Stopped sudo nohup exec php socket_axd.php adnan@vm085:~/server/axdchat/Server$ sudo nohup exec php socket_axd.php & [5] 2312 adnan@vm085:~/...
2
votes
2answers
70 views

Equation solver for the shell?

Is there an equation solver for the shell? For example, I enter input 1000=x^(1.02) and the shell solves for x.
4
votes
1answer
117 views

Executing commands in an elevated bash process by writing to the standard input of its parent script process

I have a simple bash script bash.sh that starts another bash instance using pkexec. #!/bin/bash bash -c 'pkexec bash' When executed this shows a prompt for the user to enter their password. The ...
0
votes
3answers
68 views

How do I remove a dot dollar no name directory

I have this weird directory in Oracle Linux that I cannot remove, cannot change owner, cannot change group, etc. It seems to be an environment variable that is empty and is named: .$EXTEND Here's ...
1
vote
1answer
45 views

convert update-rc.d command into chkconfig

I'm running CentOS 7.2 on my Cloud Account and following some tutorials to install Grafana. I've almost finished install but got stuck when they asked me to execute this command which used to start ...
2
votes
1answer
31 views

How can I get a help message for zsh builtin's?

If I want to get a brief usage message for a bash builtin, I can use help <builtin> at a command prompt, e.g. $ help export export: export [-fn] [name[=value] ...] or export -p Set export ...
0
votes
1answer
45 views

How to use the 'date' command to display week number of the year?

I want the UNIX date to output: So this is week 35 of 2016. Here, of course, 35 and 2016 are outputs of the date command. I have tried the following: date +%U This printed out the current week ...
2
votes
0answers
26 views

Sometimes my zsh messes the end of lines

I have this strange issue, that I cannot find the source of, nor a solution to solve. "Sometimes" my zsh gets messed up and start display end of lines in a funny way: As you can see, the newlines ...
1
vote
2answers
52 views

gunzip multiple files

I have a directory where there are multiple folders, each of folder contains a .gz file. How can I unzip all of them at once? My data looks like this List of folders A B C D In every of them ...
1
vote
2answers
49 views

How to upgrade/downgrade a specific package from “sid” on debian jessie “stable”? [duplicate]

I need to upgrade some specifics packages from sid on debian jessie stable with their dependencies. By adding the following repo : deb http://ftp.fr.debian.org/debian/ sid main deb-src http://ftp....
1
vote
1answer
53 views

Pass a list of URLs contained in a file to curl

I have to set ACL on a multiple files. I have downloaded a list of object stored using below commands. C:\Users\Gshrivastava\Downloads\curl_748_0>curl -o urlname.csv -i -k -H "Authorization: ...
0
votes
0answers
24 views

Trace route taken through multiple simulated link clicks on the Linux command-line

I have a Twitter post which links to a website. The website has a counter on it that checks the number of people who have accessed the page. However, I noticed that when looking at the Twitter ...
3
votes
1answer
45 views

Understanding the following find command

I am currently having a hard time understanding the following find command: find / -o -group `id -g` -perm \  -g=w -perm -u=s -o -perm -o=w\ -perm -u=s -o -perm -o=w \ -perm -g=s -ls  ...
2
votes
2answers
140 views

How do I double each line of piped output? [duplicate]

How do I double each line of input piped in? Example: echo "foobar" | MYSTERY_COMMAND foobar foobar
0
votes
2answers
46 views

How to burn an iso image from the command line

Is that possible to get an alternative to the command dd to burn an iso image including some options: Detect the burning device , Burn an iso image and eject the CD from the command line?
2
votes
1answer
65 views

How to delete files with ~?

I have removed all my python code from the home directory, but when I do ls I get: a11.py~ class1.pdf foobar.txt~ n1 pic.py~ When I do ls like this: ls *.py I get: ls: cannot access *.py: No ...
21
votes
5answers
2k views

How to run a command at an average of 5 times per second?

I have a command-line script that performs an API call and updates a database with the results. I have a limit of 5 API calls per second with the API provider. The script takes more than 0.2 seconds ...
1
vote
1answer
26 views

How to run a process and find how much memory it uses? [duplicate]

I regularly use time to find out how long a process takes. Is there an equivalent command for memory? The usual ways to find out how much memory a process takes (ps,/proc/meminfo, etc.) work fine for ...
2
votes
1answer
62 views

Debian : Installing Coturn causing error, and package not getting removed.

I am working on install Coturn which is an open-source Stun and TURN server. For that, I had two options, one was to download the debian package and install it by gdebi, and other was to make the ...
1
vote
2answers
332 views

Bash commands not found

I use CentOS 7 and I install anaconda and some tools, after that some basic command like clear which not work. [zhilevan@localhost ~]$ clear bash: clear: command not found... when I echo $PATH I ...
0
votes
1answer
35 views

Can all of fork(), exec() and system() be wrong? [closed]

I understand why it could be less than best practice if I write C code that executes shell commands by calling system() and that it's better to use exec and fork but then a very experienced C ...
0
votes
1answer
67 views

How to use ClamAV to scan the memory

How can I only scan the computer RAM for viruses using the ClamAV command clamscan? I already tried, because I found it on ClamWin forum: clamscan --memory But it seems, that the Linux version ...
0
votes
2answers
54 views

What can cause my shell to look like this? [duplicate]

I'm currently developing a home automation framework for my apartment. This involves getting JSON over Serial from an Arduino. When the JSON can't be parsed (usually only on startup) I log it as an ...
1
vote
2answers
42 views

how to move set of files in one-liner [duplicate]

I wanted to move 1000 files in a directory to another dir. I can do it if I'm in the original dir but if I try this mv $(ls /home/jeremy/source|tail -1000) /home/jeremy/dest from elsewhere, the ...
2
votes
3answers
41 views

Is there a way to see the dimensions of a jpeg file in linux using the command line?

I have some .jpeg images saved in a file in a cluster at school. I am at home using PuTTY to access one of the Debian nodes. I'm able to get to the folder with all the images but I need to see the ...
0
votes
3answers
31 views

How to apply dos2unix recursively to all the contents of a folder?

Is there a way to apply the dos2unix command so that it runs against all of the files in a folder and it's subfolders? man dos2unix doesn't show any -r or similar options that would make this ...
1
vote
1answer
52 views

Trying to copy/paste long script with multiple EOFs, Terminal starts running half-way through

Was trying to create a text block that I could just copy and paste into a Terminal window to accomplish something (in this case, create a systemd script to do maintenance on MySQL dbs, create a timer ...
0
votes
1answer
72 views

What is the meaning of xargs show limits output

You can use xargs to discover limits about the commandline you're using: $ xargs --show-limits Your environment variables take up 1901 bytes POSIX upper limit on argument length (this system): ...
18
votes
4answers
1k views

How can I see the whole file and also wait for more data to be added to that file?

I want to read whole file and make it waiting for input, just like tail -f but with the complete file displayed. The length of this file will always change, because this is a .log file. How can I ...
1
vote
2answers
50 views

How to find all files in /etc beginning with P

I would like to know how to find all files in the /etc file beginning with P, which I will then store the results of in a new file. So far I have $find /etc -name Unsure of what comes next.
1
vote
0answers
54 views

How to use xpra like xvfb-run?

xvfb-run allows me to open a display and run a graphical app and when the app finishes xvfb closes too. for example xvfb-run --auto-servernum --server-args="-screen 0, 1920x1080x24" nw script.js ...
0
votes
1answer
57 views

Only one line break in fasta file

I have a fasta file like: grep -A 7 -B 4 COSN229024 wrong.fasta: >COSN9627597 CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA >COSN8175610 CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT >COSN229024 ...
-2
votes
2answers
73 views

standard deviation using awk [closed]

I am using below command to get standard deviation of file A names 1 2 3 avg 23.3107 20.0372 21.7236 21.6905 awk '{x[NR]=$0 ;} END{a=$4; for (i in x){ss += (x[...
2
votes
2answers
61 views

Shrinking Raspberry Pi SD .img via Ubuntu Server (cli)

I installed Raspbian to a 16 GB card and expanded the filesystem. When I made a dd backup of the card, the .img file output was ~16 GB. Most of it is unused space in the ext4 partition—I'm only using ...
3
votes
2answers
67 views

Basic network via command line

I am using Fedora 23. Using the file explorer I "found" this page It shows where I can access other networks, I can click on them, and log in... My questions is: Is there an equivalent place ...
1
vote
1answer
60 views

Terminal color usage does not stay

I was wondering if any of you knew why doesn't my terminal keep displaying stuff colored, after I use the command ls -l -a --color=always I would like it to stay colored, so when the next time I type ...
2
votes
2answers
75 views

Does the cat command pass back a file or the contents of the file?

Compare the following commands: cat f.txt | grep "someText" grep "someText" f.txt They both seem to work. But the documentation for cat says cat outputs the contents of the file rather than the ...
1
vote
1answer
38 views

Is there a portable way to get the name of the WiFi card on the command line without additional parsing?

In this tool, the name of the wireless interface is hardcoded to be wlan0. This was a reasonable assumption up through Ubuntu 14.04, but the wireless interface name appears to have changed in Ubuntu ...
0
votes
0answers
13 views

searching through command line history [duplicate]

I use reverse search when looking for a particular command on the command line by pressing CTRL + R. That returns the first command it finds in reverse order. To go back to the next further command I ...
2
votes
1answer
70 views

FFMpeg : Converting a video file to a gif with multiple images from video

I am working on a project in which the user can upload videos. Is there any way with FFmpeg I can take some images from the video and create a GIF out of it? As the project is in Java, I have a way ...
4
votes
1answer
57 views

How to install from the command line in Arch Linux?

The company just gave us all a new virtual machine for development porpoises. It runs Arch Linux, which nobody here has experience of. The VM has no internet access, but we can side load files by ...