The command-line is the interactive interface to your shell.

learn more… | top users | synonyms (1)

0
votes
2answers
30 views

How to know which servers are connected to my unix system or user? [on hold]

How to know which servers are connected to my UNIX system or user? What I mean is that after I have logged in with my user name, I want to know which servers are connected to this user otherwise if I ...
0
votes
0answers
17 views

when rlwrap installation facing below error [on hold]

When I am installing rlwrap in Linux RHEL, I am getting below error, make: *** No targets specified and no makefile found. Stop Kindly help me to install rlwrap.
2
votes
2answers
120 views

How do I double each line of piped output? [duplicate]

How do I double each line of input piped in? Example: echo "foobar" | MYSTERY_COMMAND foobar foobar
-1
votes
0answers
57 views

How do I delete everything on my computer with one command using bash? [on hold]

I'm trying to delete every single file and directory on my computer. How do I do so?
0
votes
2answers
35 views

How to burn an iso image from the command line

Is that possible to get an alternative to the command dd to burn an iso image including some options: Detect the burning device , Burn an iso image and eject the CD from the command line?
1
vote
0answers
16 views

How do I set up user quota for /var/www?

I want to add quota per user in my Apache2 webroot. My /var/www directory is not a partition. I've found tutorials on how to set up quota for partitions, but how do I set up /etc/fstab without moving ...
2
votes
1answer
62 views

How to delete files with ~?

I have removed all my python code from the home directory, but when I do ls I get: a11.py~ class1.pdf foobar.txt~ n1 pic.py~ When I do ls like this: ls *.py I get: ls: cannot access *.py: No ...
16
votes
4answers
2k views

How to run a command at an average of 5 times per second?

I have a command-line script that performs an API call and updates a database with the results. I have a limit of 5 API calls per second with the API provider. The script takes more than 0.2 seconds ...
1
vote
1answer
23 views

How to run a process and find how much memory it uses? [duplicate]

I regularly use time to find out how long a process takes. Is there an equivalent command for memory? The usual ways to find out how much memory a process takes (ps,/proc/meminfo, etc.) work fine for ...
2
votes
1answer
22 views

Debian : Installing Coturn causing error, and package not getting removed.

I am working on install Coturn which is an open-source Stun and TURN server. For that, I had two options, one was to download the debian package and install it by gdebi, and other was to make the ...
1
vote
2answers
69 views

Bash commands not found

I use CentOS 7 and I install anaconda and some tools, after that some basic command like clear which not work. [zhilevan@localhost ~]$ clear bash: clear: command not found... when I echo $PATH I ...
0
votes
1answer
29 views

Can all of fork(), exec() and system() be wrong? [closed]

I understand why it could be less than best practice if I write C code that executes shell commands by calling system() and that it's better to use exec and fork but then a very experienced C ...
0
votes
1answer
32 views

How to use ClamAV to scan the memory

How can I only scan the computer RAM for viruses using the ClamAV command clamscan? I already tried, because I found it on ClamWin forum: clamscan --memory But it seems, that the Linux version ...
0
votes
2answers
45 views

What can cause my shell to look like this? [duplicate]

I'm currently developing a home automation framework for my apartment. This involves getting JSON over Serial from an Arduino. When the JSON can't be parsed (usually only on startup) I log it as an ...
1
vote
2answers
37 views

how to move set of files in one-liner [duplicate]

I wanted to move 1000 files in a directory to another dir. I can do it if I'm in the original dir but if I try this mv $(ls /home/jeremy/source|tail -1000) /home/jeremy/dest from elsewhere, the ...
2
votes
3answers
37 views

Is there a way to see the dimensions of a jpeg file in linux using the command line?

I have some .jpeg images saved in a file in a cluster at school. I am at home using PuTTY to access one of the Debian nodes. I'm able to get to the folder with all the images but I need to see the ...
0
votes
3answers
22 views

How to apply dos2unix recursively to all the contents of a folder?

Is there a way to apply the dos2unix command so that it runs against all of the files in a folder and it's subfolders? man dos2unix doesn't show any -r or similar options that would make this ...
1
vote
1answer
18 views

Trying to copy/paste long script with multiple EOFs, Terminal starts running half-way through

Was trying to create a text block that I could just copy and paste into a Terminal window to accomplish something (in this case, create a systemd script to do maintenance on MySQL dbs, create a timer ...
0
votes
1answer
52 views

What is the meaning of xargs show limits output

You can use xargs to discover limits about the commandline you're using: $ xargs --show-limits Your environment variables take up 1901 bytes POSIX upper limit on argument length (this system): ...
15
votes
4answers
1k views

How can I see the whole file and also wait for more data to be added to that file?

I want to read whole file and make it waiting for input, just like tail -f but with the complete file displayed. The length of this file will always change, because this is a .log file. How can I ...
1
vote
2answers
44 views

How to find all files in /etc beginning with P

I would like to know how to find all files in the /etc file beginning with P, which I will then store the results of in a new file. So far I have $find /etc -name Unsure of what comes next.
1
vote
0answers
22 views

How to use xpra like xvfb-run?

xvfb-run allows me to open a display and run a graphical app and when the app finishes xvfb closes too. for example xvfb-run --auto-servernum --server-args="-screen 0, 1920x1080x24" nw script.js ...
0
votes
1answer
51 views

Only one line break in fasta file

I have a fasta file like: grep -A 7 -B 4 COSN229024 wrong.fasta: >COSN9627597 CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA >COSN8175610 CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT >COSN229024 ...
-2
votes
2answers
55 views

standard deviation using awk [closed]

I am using below command to get standard deviation of file A names 1 2 3 avg 23.3107 20.0372 21.7236 21.6905 awk '{x[NR]=$0 ;} END{a=$4; for (i in x){ss += ...
2
votes
2answers
48 views

Shrinking Raspberry Pi SD .img via Ubuntu Server (cli)

I installed Raspbian to a 16 GB card and expanded the filesystem. When I made a dd backup of the card, the .img file output was ~16 GB. Most of it is unused space in the ext4 partition—I'm only using ...
3
votes
2answers
59 views

Basic network via command line

I am using Fedora 23. Using the file explorer I "found" this page It shows where I can access other networks, I can click on them, and log in... My questions is: Is there an equivalent place ...
1
vote
1answer
43 views

Terminal color usage does not stay

I was wondering if any of you knew why doesn't my terminal keep displaying stuff colored, after I use the command ls -l -a --color=always I would like it to stay colored, so when the next time I type ...
2
votes
2answers
53 views

Does the cat command pass back a file or the contents of the file?

Compare the following commands: cat f.txt | grep "someText" grep "someText" f.txt They both seem to work. But the documentation for cat says cat outputs the contents of the file rather than the ...
1
vote
1answer
28 views

Is there a portable way to get the name of the WiFi card on the command line without additional parsing?

In this tool, the name of the wireless interface is hardcoded to be wlan0. This was a reasonable assumption up through Ubuntu 14.04, but the wireless interface name appears to have changed in Ubuntu ...
0
votes
0answers
13 views

searching through command line history [duplicate]

I use reverse search when looking for a particular command on the command line by pressing CTRL + R. That returns the first command it finds in reverse order. To go back to the next further command I ...
2
votes
1answer
22 views

FFMpeg : Converting a video file to a gif with multiple images from video

I am working on a project in which the user can upload videos. Is there any way with FFmpeg I can take some images from the video and create a GIF out of it? As the project is in Java, I have a way ...
4
votes
1answer
49 views

How to install from the command line in Arch Linux?

The company just gave us all a new virtual machine for development porpoises. It runs Arch Linux, which nobody here has experience of. The VM has no internet access, but we can side load files by ...
0
votes
0answers
25 views

Gnome (gdm) fails to start after command-line install

Installed gdm via the default openSUSE installer (zypper). The install completed successfully but gdm won't start from the command-line. I also have a KDE install which stalls on the loading bar, but ...
31
votes
7answers
4k views

How do I create a blank PDF from the command line?

I recently needed a single blank PDF page (8.5" x 11" size) and realized that I didn't know how to make one from the command line. Issuing touch blank.pdf produces an empty PDF file. Is there a ...
3
votes
3answers
62 views

Using grep/sort/find to extract unique values

I have a bunch of text files that are named in YYYYMMDD.Txt format (so today would be 20160420.Txt). Each file is basically a log that contains a timestamp and and a unique ID, each value is ...
1
vote
0answers
21 views

How to configure maven plugin from command line?

I'm trying to configure JaCoCo maven plugin from command line insted of using pom.xml. I have managed to execute prepare-agent so far with command: mvn -X -Djacoco.destFile=./coverage/jacoco.exec ...
11
votes
7answers
936 views

Move first N lines of output to end without using temporary file

Imagine an output of a command like 44444 55555 11111 22222 33333 how can I yank the first N lines (first two in the example above) and append them at the end, but without using temp file (so only ...
4
votes
3answers
347 views

What's the quickest way to find duplicated files? [duplicate]

I found this command used to find duplicated files but it was quite long and made me confused. For example, If i remove -printf "%s\n", nothing came out. Why was that? Besides, why they used xargs ...
-4
votes
1answer
49 views

Is the value of a variable lost after a command is executed?

There is a functional difference between using: n=$1 shift And using: n=$1; shift in bash and zsh: the value of n is lost after the shift is executed in the first example. But both have the ...
0
votes
3answers
45 views

Get the file with the maximum month year

I have a requirement to get the file with the maximum month year. We have files in a directory as below: Zmx_0416_control.txt Zmx_0316_control.txt Now from these files, I need to get the file ...
0
votes
0answers
27 views

CLI connection from Raspberry Pi3 to bluetooth in solar PV inverter

I am new to bluetooth & trying to learn more so I can connect to my inverter. We have been able to use various command-line tools to: - scan & find my bluetooth mac address. - browse the mac ...
3
votes
1answer
66 views

command line tool to reserve code high light in output file?

For example, when using ack to search code in source files, the output is high lighted. But if you pipe the output into a local file, you lose the code high light. Do we have a command line tool to ...
0
votes
4answers
64 views

grep all strings that start with a certain char, and finish with another char

I need to grep all strings that start with "[" and finish with a certain string, e.g. "apal". So all chars in between these 2 chars would be shown as well. Given an input such as: ...
0
votes
2answers
18 views

Website is active but domain name not showing on WhoIs lookup from Linux command-line

I am trying to lookup the WhoIs entry for the following domain: anorien.csc.warwick.ac.uk However, while typing the URL directly into the browser displays a web-page, when I type: whois ...
2
votes
3answers
39 views

Show character at position in a file

I would like to print the character at a given position using only the command line. E.g.: <command> 5 Would output a if the 5th char of that file was a. Since I am dealing with big files, ...
2
votes
1answer
26 views

Is there any way to detect file type and open it with GUI in terminal in Fedora? [duplicate]

For example , there are two files a.ppt and b.jpg . And I can call a magic method to open them appropriately just like : magic_method a.ppt magic_method b.jpg And it open libreoffice writer and ...
1
vote
0answers
23 views

What command is gimp using to print?

All programs/commands I attempt to print certain PDFs with (lpr, lp, Okular, Evince, Xpdf) print solid black pages. The one exception is Gimp, which allows me to import PDFs one page at a time and ...
0
votes
3answers
40 views

Using grep and looking for unique occurrences [duplicate]

I have a text file of this type, and I would look for any lines containing the string Validating Classification and then obtain uniquely the reported errors. I do not know the types of possible ...
3
votes
3answers
190 views

How to list available packages in a specific repository on Debian?

Is that possible to list available packages in a specific repository on debian jessie using the command line?
2
votes
1answer
62 views

Create a file of fixed size with specific contents

I want to create a file of fixed size (1G, 10G, 100G etc) with a single random word of length within the specified limit on every line. I basically want this to run a benchmark which will sort the ...