awk - pattern-directed scanning and processing language

learn more… | top users | synonyms

4
votes
3answers
1k views

Change the text on a single line number in multiple text files

Suppose that I have ten bash shell scripts: script1.sh, script2.sh, ..., script10.sh. Initially, all ten files are identical. Now, I would like to make two changes in each script: In each file, ...
4
votes
2answers
585 views

Use sed or awk to join lines in a certain pattern?

Not sure on how to turn this input: A B C apartner bpartner cpartner into this output: A apartner B bpartner c cpartner I have this pattern in a 80 line file that needs to be 40 line. Also, how ...
4
votes
4answers
2k views

How to echo an escaped string

How can I echo an escaped string that contains $ in Bourne Shell? user@server:~$ cat test.sh #!/bin/sh echo $1 user@server:~$ ./test.sh \$sad\$test $sad$test I want it to return an escaped ...
4
votes
3answers
118 views

Remove duplicate lines while keeping the order of the lines

[root@server]# awk '!seen[$0]++' out.txt > cleaned awk: (FILENAME=out.txt FNR=8547098) fatal error: internal error Aborted [root@server]# The ""server"" has: 8 GByte RAM + 16 GByte SWAP, x>300 ...
4
votes
2answers
232 views

grep for repeated values from pattern list

I have file A.txt which is a lists of unique ids (column 1) and its corresponding values(column 2): A.txt ABC1D_T1_B1 123.4 ABC2D_T1_B2 146.7 ABC3D_T1_B1 567.8 ABC4D_T0_B2 96.8 ABC1D_T0_B1 ...
4
votes
2answers
342 views

Merge fields in a file

I have a file with 7 columns, a GFF file having chromosomal regions.I want to collapse the rows where REGION ="exon" to only one row in the file.The row has to be collapsed on the basis of regions ...
4
votes
2answers
194 views

AWK - a question about columns

I have a question. I was trying to deal with it by myself, but it seems like I am too new in awk to make it work. Let's assume that we have a file (eg. database.txt) (values are tab-separated): ...
4
votes
1answer
2k views

How to find out common elements between two files?

For an example, I have 2 files having following info: File #1: 12 13 14 15 File #2: 12 1 13 2 14 2 15 6 16 7 17 8 Output File: 1 2 2 6 In the output file, I want only the second column ...
4
votes
5answers
2k views

extract fields from “tail -f” of a syslog stream

Example line from syslog file: Aug 1 10:25:50 10.10.10.1 id=firewall sn=XXXX time="2012-08-01 14:35:18 UTC" fw=x.x.x.x pri=6 c=1024 m=537 msg="Connection Closed" f=11 n=195273698 ...
4
votes
6answers
2k views

Grep a directory and return list with line numbers

I'm currently trying to learn more about bash scripting and all of that fun stuff, and I pieced together this little command: find $path | xargs grep -n $pattern | awk '{print $1}' While this DOES ...
4
votes
2answers
436 views

Get specific line from command output in awk

I have used pipeline to read specific record from impala shell.Here is what I got [cloudera@localhost ~]$ echo "select * from abc where key > 'a-26052014015400' limit 1;" | impala-shell Starting ...
4
votes
3answers
389 views

UNIX paste columns and insert zero's for all missing values

I would like to merge specific columns from two txt files containing varying number of rows, but same number of columns (as shown below): file1: xyz desc1 12 uvw desc2 55 pqr desc3 ...
4
votes
2answers
155 views

How can I delete all unordered lines from a text file?

Overview Consider an ordered list interspersed with unordered elements, e.g.: Alligator Ant Falcon <-- Baboon Badger Armadillo <-- Caiman Cat How can this list be processed so that all ...
4
votes
2answers
495 views

How can I round all numbers in a file?

How can I round all numbers in a file that countains several columns of numbers up to a certain precision? Can this be done with awk? A single line looks like this: text - 0.1655456615 - 0.158645 - ...
4
votes
3answers
3k views

Remove string from a particular field using awk/sed

I have a file (>80,000 lines) that looks likes this: chr1 GTF2GFF chromosome 1 249213345 . . . ID=chr1;Name=chr1 chr1 GTF2GFF gene 11874 14408 . + . ...
4
votes
3answers
435 views

How to parse a file to extract 3 digits numbers kept in a “group number”

I am a beginner, and trying to write a shell script to parse a text file that is extracted from a standardization pdf file. I would like for each test group (identified by Group 0, Group 1... to get ...
4
votes
3answers
605 views

awk + print lines from the first line until match word

I want to print all lines from file until the match word please advice how to do that with awk for example I want to print all lines until word PPP remark the first line chuld be diff from AAA ( ...
4
votes
2answers
88 views

Get the maximum sum for a file on 2 keys

I have a file as below. key1 key2 key3 a1 2 l1 a1 2.5 l2 a2 2 l2 a3 2.5 l3 a3 2.1 l4 a3 2.2 l5 I am trying to find the maximum possible sum of key2 that satisfies the ...
4
votes
1answer
228 views

Looking for lines which is in one file but not in other using Unix and Awk

I have 2 files with 7 fields and I want to print the lines which are present in file1 but not in file2 based on field1 and field2. Logic: I want to print all the lines, where there is a particular ...
4
votes
3answers
265 views

Check for, and add, missing timestamps to individual lines in a file

I have a file in the following format: ABCD 01206001022T01YA022T01YA022T07SO 09:20:38 ABCD 01206001022ACION 09:24:40 ABCD 04006001021S01UK 09:24:42 ABCD 7878696621321312 23213213213213 ABCD ...
4
votes
3answers
8k views

How can I use SED or AWK to replace placeholders in a template file with variable content that contains special characters?

CentOS 6.3 I'm trying to get a small script to send an email containing a copy of email headers in the body (for the purpose of internal reporting). The template file contains the following: ...
4
votes
1answer
2k views

awk high precision arithmetic

I am looking for a way to tell awk to do high-precision arithmetic in a substitution operation. This involves, reading a field from a file and substituting it with a 1% increment on that value. ...
4
votes
2answers
280 views

only output when first columns are the same

INPUT: [USER@NOTEBOOK ~/proba] find . -type f | xargs -I "{}" md5sum "{}" | sort 18b17ef2e55f6fd2deb044943a8a769d ./yes 2b00042f7481c7b056c4b410d28f33cf ./tt.txt 2b00042f7481c7b056c4b410d28f33cf ...
4
votes
1answer
3k views

escaping a single dot with double backslash - awk

"effective awk programming" book has an example on Field-Splitting. here is the example: If you want fields to be separated by a literal period followed by any single character, use ‘FS = ...
4
votes
2answers
4k views

My awk program to change spaces into tabs doesn't work

How to write a shell script which uses awk to read in the data file students.txt and output the data in the tabbed format as shown: Surname Forename MSc Stream Date of Birth Smith John IT 15.01.1986 ...
4
votes
1answer
247 views

Matching Five Columns in two Files using Awk

I have two Input files. File1: s2/80 20 . A T 86 F=5;U=4 s2/20 10 . G T 90 F=5;U=4 s2/90 60 . C G 30 ...
4
votes
2answers
4k views

recursive search for a pattern, then for each match print out the specific SEQUENCE: line number, file name, and no file contents

What I am after is almost exactly the same as can be found here, but I want the format "line number, separator, filename, newline" in the results, thus displaying the line number at the beginning of ...
4
votes
1answer
2k views

Awk to remove line if argument is encountered in a specific column

I need to cycle through an entire file of unknown size and remove any line in which a given word (passed in as argument 1) appears in a specified column. In addition, I need to keep track of how many ...
4
votes
2answers
622 views

AWK help for filling up rest of the columns with &nbsp in file

I'm trying to get AWK filling up following text file for "empty" columns". Basic idea of finding longest line with AWK NF and checking which line has no value on that column. Then adding x times N/A ...
4
votes
2answers
927 views

Moving average on a log file with awk or other unix utilities?

Scenario: I have a log file that has a few number of entry "classes", like this: R0 dx=0.00500 rb=0.00000 sn=1 3145.88 2.59 0.08 se=21315 id=16190 R0 dx=0.00300 rb=-1.00000 sn=1 3150.40 2.38 0.05 ...
4
votes
1answer
163 views

Why does awk '{print “Hi, Judy”}' print “Hi, Judy” repeatedly when pressing Return?

For my understanding, usually awk follows a file or an output. Then it will exec its code on everyline of that file or output. In my case, my command awk '{print "Hi, Judy"}' didn't follow by any ...
4
votes
5answers
229 views

how to split file and lines

I have a text file like : 1_01 { ; quite good spirals reset=2000 type=mandel passes=1 corners=-0.6014129278/-0.5990935452/0.427747516/0.429487053 params=0/0 float=y ...
4
votes
3answers
111 views

awk separator preferences

I write ad hoc awk commands in cygwin to process tab delimited files. Pretty much every command starts with: BEGIN {FS="\t";OFS="\t";ORS="\r\n";} How can I make these separators the default to ...
4
votes
1answer
1k views

Pass colors from ls through pipe to awk 'print' statement

This is a follow-up to my question from yesterday, Show sum of file sizes in directory listing. Thanks to Zero Piraeus and a point in the right direction by Mauritz Hansen, I now have function ...
4
votes
3answers
5k views

How to list all unique ip address currently connected to a specific port?

Say I want to know how many unique clients are connected to port 5222 on a server. Can you find a way better/faster/stronger than this? netstat -nt | grep ':5222.*ESTABLISHED' | awk '{ print $5 }' \ ...
4
votes
2answers
836 views

How to test if a function is defined in awk?

I am writing an awk program and I want it to run it both with mawk and gawk. I need a sorting function. I have written my own, but I want to use the builtin asort() function in gawk if available. How ...
4
votes
5answers
799 views

Multi-line grep beween two tags, only show the last match

I'm having a program that intermingles data segments into log output: log message log message ----BEGIN INLINE DATA---- data data data -----END INLINE DATA----- log messge I'm looking for something ...
4
votes
1answer
312 views

Are there awk versions that provide syntax for computing aggregations?

From time to time I find myself writing awk scripts that compute some simple statistics. For example computing a histogram, the average of a value, the standard deviation or even the variance ... ...
4
votes
6answers
423 views

What is the easiest way to check if column A and B values goes both ways with AWK? [closed]

What is the easiest way to check if column A and B values goes both ways? Output to check: Mike John John Mike Pamela Barbara Barbara Pamela Mike Paul Roger Paul Desired output Mike <-> ...
4
votes
1answer
450 views

Efficient way of comparing in awk

#!/bin/awk BEGIN { while(getline var < compareTo > 0) { orderIds[var]=var; } } { if(orderIds[$0] == "") { print $0; ...
4
votes
2answers
60 views

How to print matching value of patterned field separator in AWK

In the below command, cat abc.txt|awk -F"[0-9]+." '{print FS $3}' Here FS prints [0-9]+.. However, I want the awk to print the matched value by that field separator e.g. "99." . Any idea how can ...
4
votes
1answer
74 views

Insert missing data within blocks

I`m a biologist and I am trying to solve this problem, please guide me on where to start. I do not know which forum to post this in, please let me know if this place is not appropriate. I have blocks ...
4
votes
2answers
75 views

How to cut from the 1st character to -7 character in awk?

I have a file with multiple lines. Which the second column is the user_id, but the last seven number are random numbers. It need to be trimmed off to get the authentic ID. So what I need is to get ...
3
votes
7answers
3k views

Problem in splitting a string using awk or cut command

I have a properties file which has a password field (key value pair) PASSWORD=NDhhHcsOBofXUdUzGw5B0Q== I am trying to get the value in my shell script using the awk command password=`awk -F "=" ...
3
votes
6answers
738 views

Add a symbol before any letter

I have a text file with each line having some defined number of fields but they can differ from line to line. All I want to do is to add "=" sign in front of every value in the field in that line. ...
3
votes
3answers
1k views

reading entries from multiple files

I have few files like A.txt, B.txt and C.txt, each having a only single number in it i.e A.txt has 45 B.txt has 35 and C.txt has 100. How could I read these entries from each files and report with its ...
3
votes
5answers
239 views

removing extensions in a column

I have a file like this ILMN_1343291 TGTGTTGAGAGCTTCTCAGACTATCCACCTTTGGGTCGCTTTGCTGTTCG NM_001402.5 ILMN_1343295 CTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTG NM_002046.3 ILMN_1651209 ...
3
votes
3answers
214 views

Parse multiple sections of data into seperate files

I have a concatenated log file with multiple logs inside that I'm trying to parse out into individual log files (I will later rename them to the date/time of each). Each log is separated by "--- LOG ...
3
votes
2answers
388 views

Delete every Nth line in shell

I'm trying to delete a line after N lines using awk and I can't seem to get it right. The file format is like this YYYYYY XXXXXX XXXXXX YYYYYY XXXXXX XXXXXX The real example would be office3 3 1 ...
3
votes
4answers
277 views

Count how many elements in the nth column in a whole file

Input file: A 1,2,3,4 #length($2)=4 B 1,2 #length($2)=2 C 9,8,7,6,5,4 #length($2)=6 Expected output: 12 #4+2+6 A method like: awk -F '[\t,]' '{print length($2)}' but ...