awk - pattern-directed scanning and processing language

learn more… | top users | synonyms

1
vote
1answer
46 views

How to print incremental count of occurrences of unique values in column 1

I'm trying to come up with an solution to this problem, I need to incrementally count and then print the counts of the unique values in column 1 of a tab delimited text file. Here is an example: ...
0
votes
1answer
85 views

Avoid conversion to scientific notation in awk

I have a csv file that contains hundreds of columns. I would like to subtract the value of a specific column from a static number and then print the entire line. The values of that column are long ...
1
vote
2answers
45 views

Appending an input file with awk after a pattern (looping?)

I am trying to take a text file called 'input', of the form line1 line2 line3 PATTERN x y z x y z lineN and use awk to place a number (1) after each "x y z" line. I need the lines before the ...
1
vote
1answer
167 views

remove lines where a field's value is less than or equal to 3 - sed or awk?

I need to remove every line that has a value of 2 or less in the 8th field (column). My data looks like this: 12-31 Airport 189 379 41 49.70946503 -124.91377258 2 2880 30.8 01-01 ...
3
votes
5answers
214 views

Pick the latest file based upon the sequence number given in the file name

I have a requirement, I have few files in a directory, I need to pick the oldest one for processing. For Exp: I have below files in /tmp directory: Sample_0000237826-001_xyz.dat ...
0
votes
0answers
11 views

use php variables for awk regex commands [duplicate]

trying to implement autosuggest using php. autosuggest list generated using awk $input= $_GET["term"]; $suggest=array(); exec('awk \'BEGIN{FS=","}/.$input./{print $2,"-cost-",$1}\' ...
2
votes
3answers
105 views

Find the number FN with awk

I have one document, and this document has several columns, like this: ,Flag2,,Flag4,Flag5,,,,,Flag10,Flag11,Flag12,Flag13 If I use awk to know the total number of fields, knowing the separator ...
2
votes
2answers
113 views

How do I insert new columns into a .csv file?

Example Data: "Monday","12345","Friday" In the above file, I want to add a new column in between 12345 and Friday. How can I do that ?
0
votes
3answers
49 views

Separating names separated by “| character” to individual pairs

I want to separate the names in the same line into separate individual pairs. TMPRSS2|pp9284 AADAT Sample1 ERG TMPRSS2|pp9284 Sample2 TMPRSS2|pp9284 ETV1 Sample3 PDE4A ...
0
votes
3answers
66 views

Awk/sed command to cut on multiple delimiters [closed]

I have input file name as: Sample_0000860156-001-out_20150224150524.xml.gz I want only 0000860156-001 from the file_name to append to my target file name.
7
votes
4answers
236 views

Matching and pasting to line

So I have 2 very big text files, consisting of lines like so: First: Robert:Dillain:Other:Other:Other Julian:Brude:Other:Other:Other Megan:Flikk:Other:Other:Other Samantha:Minot:Other:Other:Other ...
1
vote
1answer
183 views

Print lines between two patterns matching a condition in awk

How can I print lines between two patterns which meet a certain condition? For instance for an input file partially containing the following: Time %MEM %CPU %SWAP 00:05:02 7.3 ...
4
votes
4answers
3k views

Redirecting Output of print to multiples files in awk

I want to print same lines to 2 different files. What I am doing right now is: print ID[i]" "Value[i]" "TS1[i]" "TS2[i] > "file1.txt"; print ID[i]" "Value[i]" "TS1[i]" "TS2[i] > "file2.txt"; ...
0
votes
1answer
31 views

Printing out range of a pattern with awk

Im trying to print out a section of a txt file using awk. Basically I want to print out the paragraph in the a txt file that begins with certain words all up to a blank line.Here's what I have so far: ...
2
votes
3answers
1k views

Trouble in adding a column with awk

I'm trying to add a column to a csv file by using: awk -F "," '{print $0"new_col"}' file.csv but I got : new_col8,0.405,0.101 new_col4,0.374,0.100 new_col23,0.342,0.100 new_col130,0.298,0.100 ...
2
votes
3answers
82 views

how to use awk/cut to get column data which has space

I have data in below format: 16 SQL*Plus vilconv1 dox-conv2 16 TOAD background query session Disha WORKGROUP\AD now I want to ...
1
vote
2answers
113 views

Last line is wrong when splitting a file with awk

I have a data file main.txt that looks like this 20130826,aaaaaaaaaaaaaa,bbbbbbb 20130826,sdfasdfasdfas,sdfasdfasd 20130826,dfasdfas,asdf2323 ... 20130827,sfasdfasdfasd,sdfasdfwea I used the ...
1
vote
1answer
60 views

Single record of a file getting splitted over multiple lines

We are using flat text files to store in teradata table after transformations from Informatica. The file contains 14 fields (~ separated). But as the records are getting scattered over multiple lines ...
13
votes
8answers
12k views

How to print certain columns by name?

I have the following file: id name age 1 ed 50 2 joe 70 I want to print just the id and age columns. Right now I just use awk: cat file.tsv | awk '{ print $1, $3 }' However, this ...
2
votes
2answers
84 views

Expose awk over tcp (inetd, socat, etc.)

I was playing around with awk, and I wanted to expose it over a tcp socket. At first I tried, but failed with micro-inetd. Thinking that maybe the issue could be in the way that carriage ...
3
votes
3answers
10k views

Insert text in specific lines of a file?

How can insert some text in specific lines of a file? What is most simplest method that I can use? (bash, sed, awk?) What I want to do, might be simple, but I don't know where I should start. It's ...
0
votes
1answer
64 views

Space removal after a pattern in SED

I have a file instrument.xml bash-4.1$ more instrument.xml <instr instr_id="CPT-2380950-011-001-826" valor_ch="" instr_type="CurrentAccount" instr_name="CPT-2380950-011-001-826" qn_type="1" ...
0
votes
2answers
180 views

Compare two csv files and append value using awk [closed]

I have two files as follows: file1.csv Account_ID,Asset_ID,LOT_ID,FLAG_F1 10000,20000,30000,Y 10001,20001,30001,N 10002,20002,30002,Y 10003,20003,30003,N 10004,20004,30004,Y 10005,20005,30005,N ...
11
votes
9answers
35k views

Show sum of file sizes in directory listing

The Windows dir directory listing command has a line at the end showing the total amount of space taken up by the files listed. For example, dir *.exe shows all the .exe files in the current ...
2
votes
2answers
1k views

Remove lines based on duplicates within one column without sort

I have large 3-column files (~10,000 lines) and I would like to remove lines when the contents of the third column of that line appear in the third column of another line. The files' sizes make sort a ...
3
votes
4answers
160 views

Replace a marker in a text file with arbitrary new text

I have a file which contains some text and - on a single line - a marker which indicates where new content should be added foo bar %SUBSTITUTE% foo The line line substitute should be replaced by a ...
24
votes
12answers
6k views

Remove duplicate $PATH entries with awk command

I am trying to write a bash shell function that will allow me to remove duplicate copies of directories from my path environment. I was told that it is possible to achieve this with a one line ...
0
votes
3answers
46 views

Split the file comparing two fields in the files

Have two files which need to compare the first two columns. Sample input file1: |CID|SID|order|orderdate|confirmdate |151244127820|7177638911583| 2|2015-02-04 07:14:44|2015-02-04 07:15:32 ...
2
votes
1answer
52 views

how can I add an extra character after a word search [closed]

I have the following field names demelog voyapro naisjdf naismc decoide decoccm travide travccm equiccm mariccm Below is a sample of my file. There are more columns before the first fck=83... ...
2
votes
2answers
139 views

Delete rows from a simplified CSV where some columns matching specific pattern

I have the following simplified CSV file (no separators or newlines embedded in fields): ...
1
vote
1answer
182 views

grep (/sed/awk) month range

I've looked around for solutions to this, but it's sort of difficult to search for the solution to such a specific problem (lot of words to put in Google). So, I have a file with data that looks like ...
1
vote
2answers
387 views

extract blocks of text from xml file

I have a file with these contents: <People> <Person> <Name>Joe Blogs</Name> <Address>55 Oxford St</Address> ...lots of other properties ...
2
votes
3answers
137 views

How to insert bash variables in awk?

How to insert bash variables in awk (for example i need to do in in some for loop - like this: in first iteration use awk to search string by first column, next by second column and so on with using ...
1
vote
3answers
80 views

Filter csv file based on extended column values

I have the following csv file: ID,PDBID,FirstResidue,SecondResidue,ThirdResidue,FourthResidue,Pattern RZ_AUTO_1,4tov,1404,1405,1518,1519,CG/AA Canonical ribose-zipper ...
6
votes
4answers
1k views

find length of longest line in all text files in a directory

I know how to get length of the longest line in a text file with awk awk ' { if ( length > L ) { L=length} }END{ print L}' file.txt but how can I get the length of the longest line of all files ...
0
votes
2answers
81 views

what are considered old and powerfull commands? [closed]

I came across the terms awk and sed, awk goes once through all lines and performs a task whenever a line meets a certain condition, sed can manipulate a stream of input before it goes further to the ...
0
votes
3answers
87 views

How can I output sample rows from a .csv?

I'm doing a lot of data merge printing and would like to be able to output, say, 10 samples from a large database. My goal would be to extract the 10 rows spread evenly from the supplied .csv ...
4
votes
3answers
228 views

Can tr commands be chained to avoid multiple tr processes in a pipeline?

I have a bunch of txt files, I'd like to output them lower-cased, only alphabetic and one word-per line, I can do it with several tr commands in a pipeline like this: tr -d '[:punct:]' ...
0
votes
2answers
39 views

How to match multiple lines starting with a TAB, and the line before the 1st one in a group?

I've got some third party log files I'm trying to pull errors out of on the command line. The logs look like this: time=1 time=2 time=3 at com.test.com.... at com.test.com.... at ...
0
votes
2answers
129 views

awk print a match only if last record before other match

I want to use awk for printing a match of some pattern, only if it is the last line of the file before some constant text. For example, i want to print the value of "c" only if it is the last line ...
2
votes
2answers
756 views

Delete rows in a simplified csv file (one newline per row) based on a specific column value

I have a csv file with the following headers - Interaction_ID, PDB_ID, First_Residue, First_Chain, Second_Residue, Third_Residue, Third_Chain & Pattern: ...
-1
votes
1answer
715 views

search for a character in one column and replace value in another column of matched records

I have a requirement to find value 2 in column 4 and wherever it matches replace 6th column with '-'sign in the beginning suppose if i have csv file - file1 like this abc,0,def,1234,ijk ...
1
vote
2answers
100 views

Remove a line if regex exists only in 1st column of each line in a csv file

I have the following comma-delimited data (spaces used for visual clarity): 1 2014 23 2352 19.24 7.18 1 2014 23 2353 19.78 4.65 24 2014 23 2354 20.26 25.34 1 2014 23 2355 26.65 42.76 1 2014 23 ...
2
votes
2answers
41 views
8
votes
4answers
560 views

Output part of each line to a separate file

I have a file like this: a AGTACTTCCAGGAACGGTGCACTCTCC b ATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCATGCTCCAT c ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCATGCTCCATCCACTCCACAC d ...
0
votes
1answer
38 views

Run unix command on awk field [duplicate]

I want to run the basename command on a certain awk field. echo "1 /this/is/a/path" | awk '{print $1" "system("/usr/bin/basename " $2)}' but the output always produces a 0 from the system command. ...
0
votes
1answer
31 views

Filter by column value and write to file

I have a table like this: BB1520_v1.0_0103 exon 3329 3601 BB1520_v1.0_0103 exon 3650 4040 BB1520_v1.0_0089 exon 1 862 BB1520_v1.0_0089 exon 1312 ...
0
votes
1answer
98 views

Reading a string till a key word and replacing from there with another string

I am new to UNIX and am practising shell scripting. I have an application where I need string searching and replacement. There are some lines in a file 1 and file 2. I have a search key word. If the ...
1
vote
1answer
80 views

When will awk treat newline character as `;` and when not?

I'm reading the famous awk tutorial from http://www.grymoire.com/Unix/Awk.html. In which it mentioned To be precise, in the original AWK you can insert a new line character after the curly braces, ...
3
votes
3answers
298 views

Why awk understand FS=“*” but not for FS=“-*-”?

I got a test file, its content is: a -*- b I used awk 'BEGIN {FS="*"} {print $2}' test, it prints out - b Correct! But when I use awk 'BEGIN {FS="-*-"} {print $2}' test, I got: * I know that ...