awk - pattern-directed scanning and processing language

learn more… | top users | synonyms

-2
votes
1answer
2k views

convert CSV to XLS file on linux [closed]

The following Perl script can convert CSV file to XLS file the problem is that I need to install on customer Linux machine many Perl modules in order to run this Perl script , and actually I cant ...
0
votes
3answers
153 views

How does the following shell script work in finding all files larger than 20MB?

I came across a post advising that the following will find all files greater than 20Mb in size. find / -type f -size +20000k -exec ls -lh {} \; 2> /dev/null | awk '{ print $NF ": " $5 }' | ...
0
votes
5answers
82 views

df -k + how to match the root volume line

please advise how to match the "/" volume from df -k command? I tried the following: [root@machine /]# df -k | grep "/" /dev/vx/dsk/bootdg/rootvol 130926685 71378710 58238709 56% / /devices ...
1
vote
2answers
54 views

Extracting file name and string from multiple files

I have a lot of files (>100,000) from which I would like to extract a specific string and the filename itself. Files are organized like this: Filename: sequence.php?ID=gi|90022703|ref|YP_528530.1| ...
0
votes
1answer
65 views

Finding words with one vowel group

I am trying to use a command to find all words in a list of words with one group vowels. Like four, for and far, but also words like ore and or. What I got so far: grep -i ...
1
vote
3answers
68 views

Find a string in one section of a file with mutiple sections

How to sed/awk for a string contained in another string. TESTVAR=' { icon : "icons/773_l.png", id : 80, initialState : true, isPng : false, label : "Imagery", opacity : 1, requestType : ...
4
votes
4answers
172 views

How to remove all comments from a file?

I have a file with a few lines commented out: foo bar stuff #Do not show this... morestuff evenmorestuff#Or this I just want to print all the uncommented code: foo bar stuff morestuff ...
1
vote
0answers
141 views

extracting data from a log file and plotting it using Gnuplot

I have a logfile with the following data in it: Sat Sep 20 11:25:01 BST 2014 -- temp=53.0'C -- message from script /usr/src/scripts/wifi_test_2.sh Sat Sep 20 11:26:01 BST 2014 -- temp=53.0'C -- ...
1
vote
4answers
146 views

splitting a column using awk

I have a file like shown below. The 9th column has values joined by **. chrXV 234346 234546 snR81 + SNR81 chrXV 234357 0.0003015891774815342**0.131826816475 + chrXV 234346 ...
1
vote
2answers
113 views

Extract text from one iteration of top

I want to execute the top command from my bash script the problem is that usually when I type the top command on the console , I exit by Ctrl+C. but how to exit from top when I run the top command ...
-1
votes
1answer
75 views

search for a character in one column and replace value in another column of matched records

I have a requirement to find value 2 in column 4 and wherever it matches replace 6th column with '-'sign in the beginning suppose if i have csv file - file1 like this abc,0,def,1234,ijk ...
2
votes
1answer
78 views

Getting matched fasta file

list.txt 58759__len__2903 58759__len__2903 673957__len__1655 673957__len__1655 3566454__len__1744 seq.fasta >58759__len__2903 TTTTCCGTAGAGGAGATCCCTATTTTTAGGTTTGTAAGAGATCATTTT ...
-1
votes
1answer
69 views

Match and combine records in Bash [duplicate]

Consider two csv files: $ cat given.csv 123,John 246,Paul 369,George 987,Ringo $ cat family.csv 246,McCartney 123,Lennon 987,Starr 369,Harrison Note that the lines are not ordered! How might I use ...
2
votes
1answer
57 views

Substitute one field with other if its entry starts with specific letter

If I have a file something like: 223 898 teeth 223 899 mouth 223 900 r9 445 800 round My question is how can I use awk command to substitute column 2 with column 3, only for the row in which column ...
0
votes
2answers
56 views

Convert two rows to two columns

I would like to convert every two rows to two columns using awk. Any help appreciated. input.txt: # Query: gi|11465907|ref|NC_001872.1| Chlamydomonas eugametos genome, complete genome # 0 hits found ...
2
votes
2answers
43 views

Gather job usage information on cluster

I am running simulations on a linux cluster shared by hundreds of other users. There is a job scheduler installed on the cluster that determines who runs where, and one of the scheduler commands ...
8
votes
2answers
288 views

Reindexing a large CSV file

I went through the answers in this helpful thread, but my problem seems to be different enough that I can't think of good answer (at least with sed). I have a large CSV file (200+ GB) with rows that ...
2
votes
3answers
126 views

Use AWK to pad date and time formats

I would like to use AWK to pad the date and time fields in my report. Here is my current .csv that is actually tab delimited. AA 9/7/2014 2:30:38 PM AA0000011111 08 Y A Jane, Doe AA ...
2
votes
3answers
49 views

Merging two tables including multiple ocurrence of column identifiers and unique lines

I asked a similar question yesterday (Merging two tables including multiple ocurrence of column identifiers) but ran into a problem with unique lines. I would like to merge two tables based on column ...
4
votes
6answers
203 views

Sed — Replace first k instances of a word in the file

I want to replace only the first k instances of a word. How can I do this? Eg. Say file foo.txt contains 100 instances occurrences of word 'linux' . I need to replace first 50 occurrences only.
2
votes
2answers
113 views

Merging two tables including multiple ocurrence of column identifiers

I would like to merge two tables: File 1: 1 today 2 tomorrow 3 red File 2: 1 a lot 1 sometimes 2 at work 2 at home 2 sometimes 3 new Desired output (file 3): 1 today ...
0
votes
4answers
153 views

Use SED or AWK to move rows to columns

I have a report that is generated in rows and I need to move it to columns. The number of rows per record will always be the same. This will be in a BASH script on Linux, so I would like to use ...
1
vote
1answer
46 views

Take the subset of the file related to the time stamp

I have some json file in dictionary format. The lines looks like here: {"a":"1", "b":"2", "c":"3", "time":1334572551435} {"a":"1", "b":"2", "c":"4", "time":1334575352456} {"a":"2", "b":"2", "c":"7", ...
1
vote
1answer
92 views

Sed / awk script for a non-standard apache access log ( Oracle Weblogic )

I have hit a wall with my limited sed scripting abilities, and i wonder if any of you guys could help me out. I have a non-standard apache access log with the following format: #Version: 1.0 ...
1
vote
4answers
140 views

How to split text file into records by first non-blank charecter using awk and print only records containing string

I have a text file with information separated in blocks. I would like to separate these blocks into records so that I can handle them separately. This is my text file (file.txt): Alarm Stats: ...
1
vote
4answers
75 views

Parsing complex text file using Unix commands

I have the following text structure which I would like to parse: >Cluster 423 0 56aa, >HWI-ST1448:257:C3V2HACXX:1:1106:19087:2550.1... at 92.86% 1 64aa, ...
3
votes
2answers
213 views

awk: Extracting a fixed number of rows where the last row number may vary

This question may look like a duplicate, but only at first glance. Of course, I would no longer need help in how to code a one-liner that extracts a fixed number of continuous lines (e. g. 5 in this ...
1
vote
2answers
79 views

Use awk to find first occurrence

I have a log file that gets updated when my script runs. The script will insert "Start of script" text when it starts and "End of script" text when it finishes running. I am trying to capture the ...
0
votes
3answers
49 views

How to Print certain Fields if a condition is met

I have a big Input file as shown below. If "PRIMER_LEFT_NUM_RETURNED" is not equal to 0 then print the corresponding SEQUENCE_ID, SEQUENCE_TEMPLATE,PRIMER_LEFT_NUM_RETURNED, PRIMER_RIGHT_NUM_RETURNED, ...
5
votes
5answers
156 views

Replace data at specific positions in txt file using data from another file

I have a text file in the below format: $data This is the experimental data good data This is good file datafile 1 4324 3673 6.2e+11 7687 67576 2 3565 8768 8760 5780 8778 "This is line ...
5
votes
3answers
128 views

How to use awk through multiple files?

I want a solution for the general case (N folder) I'm using awk to process a file and extract its content and put it in a variable then echo it: This is the file: H1 H2 H3 H4 H5 H6 H7 H8 H9 not ...
0
votes
4answers
92 views

Adding a character to every other text line

I have a huge (ca. 20G) text file which contains millions of passages (a.k.a. paragraphs) with headers. Headers and paragraphs are always one line each, e.g., Sunshine This is a sunny day. ...
3
votes
4answers
72 views

Need to remove - (Minus) sign at the end in number from many columns and insert it on columns removed

I have a huge csv file which has - (Minus) sign at the end of numbers. Now I need to move these - minus signs to begin of the numbers, i.e I need to remove the last character if it has '-' sign and ...
0
votes
3answers
34 views

AWK remove one line?

I need some help with awk. This is my uptime uptime=`uptime|grep days|awk '{print$3,$4}'` But it displays now 23 days, I want to remove , How can I accomplish that? cheers and thanks
0
votes
1answer
103 views

Haskell, C++, AWK, Bash, Lisp … Which one is faster? [closed]

I was wondering, which of these programming languages are faster at handling big data files of only strings: Haskell, C++(Boost), AWK, Bash, Lisp... So far I have found the paper Haskell vs. Ada ...
1
vote
2answers
410 views

Error: ambiguous redirect while transferring output to command

Output to redirect in script: 511@ubuntu:~/Unix/test$ ls -ltr |awk '{print $9}' default.txt dfah.txt fruit.txt fruit_prices.txt dfh.txt header.txt testfile.txt topoutput.txt Script written on shell ...
3
votes
2answers
95 views

Compare 2 tab delimited files and output differences with column header

I would like to compare 2 similar files on a common column. The files will have identical headers. file1.txt mem_id Date Time Building aa bb cc dd ee ff ...
4
votes
4answers
183 views

extract lines according to a particular column

I have a CSV file like CK,ck XYZ,xyz,xyzs ABC,abc,abcs PQR,pqr,pqrs LMN,lmn, IJK,ijk, I have to check if something is written in column 3 except whitespace, then display the whole line.the output ...
2
votes
7answers
82 views

How to replace the third character in number to other character

IPS parameter include diff IP address as: IPS="192.9.200.12-14 172.17.200.12-89 12.21.1.10-25 127.0.0.1-127" I want to replace the third “.” In the IP address number to “,” How to achieve this by ...
1
vote
4answers
43 views

Loop through array

I have records in list.txt (INPUT) as List of animals SET 1=Dog 2=Crow 3=Snake Pet,bird,reptile List of Countries SET 1=France 2=Singapore 3=Columbia Europe,Asia,SouthAmerica List of Parts SET ...
1
vote
1answer
74 views

Why is the output of this paste command split on separate lines with indents?

I was trying to merge files using either of these commands: paste data_{1..2}.txt > 1_2.txt paste <(awk '{print $1}' data_2.txt ) <(awk '{print $1}' data_2.txt) > 1_2.txt But the ...
4
votes
3answers
602 views

Replace “o” with “0” in large wordlist and save the original word?

I have a large text file with words. Every word is on a single line (typical wordlist). I want to replace all characters "o" with the number "0" in every word, and the new formed word to be pasted on ...
-1
votes
2answers
49 views

Searching out a pattern from Logs

The format of the logs is in this manner: Junk Junk Junk : Junk Junk Junk:IP/Port Junk Junk I want to search using the IP and the output should be only the IP/Port part of each line in that log ...
2
votes
4answers
312 views

Only cat from specific line X (with a pattern) to other specific line Y (with a pattern)

A little extended problem from "cat line x to line y on a huge file": I have a huge file (2-3 GB). I'd like to cat/print only from the line having "foo:" to the line having "goo:". Assume that "foo:" ...
0
votes
0answers
86 views

wget: Retrieving a list of URLs when modifying input data file on the fly

This issue is currently driving me up the wall. It just does not work as it should. I have a file inp with audio samples to download where I preserved the internal ID number by parsing some other ...
0
votes
0answers
58 views

Can sed and awk take in multiple files?

grep can search in multiple files, including those files recursively under a specified directory. This makes grep able to find which file contains a pattern. Can awk and sed also? It seems that they ...
1
vote
1answer
49 views

awk: Columns are not printed when concatenating strings is passed as command string

I've found some anomaly when writing a script. The following examples works as expected: $ echo 123 | awk '{print $1 456}' 123456 $ sh -c "echo 123 | awk '{print $1}'" 123 But the following ...
0
votes
1answer
78 views

How to copy rows of different files and paste column-wise?

I want to create a new file by copying rows of each file and pasting columnwise according to their file name orders. Here is the sample input and required output files below. file1.txt 1234 5678 ...
1
vote
2answers
65 views

awk: for-loop with break option

I am trying to use awk to manipulate data.I have a data file with two columns and I would like to find the row that contains an specific value. But there is more than one row that contains this value ...
1
vote
2answers
65 views

grep contents of files based on a list of files

Running CentOS 6.5, qemu-kvm. I have a script which builds a list of running VM's. I want to pull information from those .xml files of only the VM's that are running. cat /dev/null > ...