awk - pattern-directed scanning and processing language

learn more… | top users | synonyms

1
vote
2answers
59 views

How do i search for certain sections of a file and then extract only relevant information within that section?

So I have a text file that is a server report and has about 1000 lines of information in it. I'm trying to write a script that can search the report for only certain pieces of information I'm looking ...
2
votes
3answers
81 views

Single record of a file getting splitted over multiple lines

We are using flat text files to store in teradata table after transformations from Informatica. The file contains 14 fields (~ separated). But as the records are getting scattered over multiple lines ...
2
votes
3answers
70 views

Removing duplicates every X number of lines

Is it possible to remove only the AWD015F11 duplicate using Awk? I have a large file with one column. This happens every 24 rows. I have tried counting the rows in search for a pattern that I could ...
8
votes
9answers
500 views

awk or sed to lowercase/uppercase only one character in string?

Is there a way how to uppercase/lowercase only one character in some string? Input Example: syslog_apr_24_30 syslog_mar_01_17 Desired output: syslog_Apr_24_30 syslog_Mar_01_17 Note please the ...
3
votes
5answers
123 views

How to add column in the beginning of file using perl?

I want a Perl one-liner that checks whether the first fields of an input file is the file's name and, if it isn't, adds the file name as the first column on every line. Example written in shell : ...
9
votes
4answers
6k views

Concatenate lines by first column by awk or sed

How can I use awk in the following situation? I want to concatenate lines that start with the same column. Only the first column is kept after the join (in this case aaa, www, hhh). The file may be ...
6
votes
1answer
109 views

How can I extract/change lines in a text file whose data are separated into fields?

How can I manipulate field-based data from the commandline? For example How can I print only lines whose Nth field is foo? How can I print only lines whose Nth field isn't foo? How can I print only ...
0
votes
2answers
276 views

Compare two csv files and append value using awk [closed]

I have two files as follows: file1.csv +------------+----------+--------+---------+ | Account_ID | Asset_ID | LOT_ID | FLAG_F1 | +------------+----------+--------+---------+ | 10000 | 20000 | ...
1
vote
2answers
52 views

Using df and trying to awk a specific column

Among other problems with this script I am trying to make (this is the first unix/linux script I have ever made), I am trying to use df to get the % of disk space used and email it to the root. Our ...
7
votes
7answers
366 views

Removing numeric values in certain columns whilst keeping minus signs?

I put my hands up to being a complete beginner, so apologies if I'm doing this wrong. Say I have the following data frame that continues indefinitely horizontally and vertically with negative numbers ...
0
votes
2answers
46 views

Best way to iterate through the following awk command

I have the following awk statement awk '/^string$/{i=1;next} i && i++ <= 2' file This will search for string and then print 2 lines down. So as an example $ cat file string aaa bbb ccc ...
-3
votes
2answers
42 views

sed or awk to get a string

I have a shell script with string=<deploymentTargets xmi:type="appdeployment:ClusteredTarget" xmi:id="ClusteredTarget_143378365 7353" name="cluster1"/> I want the value between name=" and ...
0
votes
2answers
82 views

Using multiple awk commands within single line

Here is what am trying to do: My data is in sets of rows within same file (the variables vaa vbb are looping over it and am able to control it as required) What i need is to add an extra column before ...
1
vote
1answer
22 views

calculate numbers on end and merge to one line

So in a file i have lines like these: thisdata:thisother:1337 thisdata:thisother:1800 thisdata:thisother:1500 thisdata:thisother:46984 I would like to output: thisdata:thisother:51621 for all ...
-1
votes
1answer
19 views

Matching 2 different files by first column

So I have 2 different files. file1.txt is: abcdefjeiireiiioe:data:otherdata rijirjeiwrieeoooe:datamore:otherdatamore file2.txt is: abcdefjeiireiiioe:data:otherotherdata ...
1
vote
1answer
34 views

Obtaining unique lines with matching strings [duplicate]

I have a JSON like text file of records with duplicate ids that look like: {"ID":"93" , "ST":[42,77,51]} {"ID":"21" , "ST":[43,4]} {"ID":"94" , "ST":[65,11,4]} {"ID":"93" , "ST":[42,77,51,29,63]} ...
2
votes
4answers
51 views

Sum of alternate values in a column using either sed or nawk

foo.txt: 1 10 11 2 20 22 3 30 32 4 40 42 5 50 52 6 60 62 7 70 72 8 80 82 9 90 92 10 100 110 Desired Out.txt : 1 10 11 2 20 22 3 ...
1
vote
2answers
49 views

Concatenate multiple fields separately based on one (key) column

I have a tab-separated test data like this: A 1 2 B 3 4 B 5 6 C 7 8 I want to concatenate (aggregate) both column#2 and #3 based on duplicate values ...
0
votes
1answer
40 views

Convert particular lines in a text file to bold [closed]

I have a text file with 100 lines in it. I want to convert particular lines, lets say line1, line6 , line27, line 48, line 86, line99 to bold. I am using solaris 5.10, with KSH. Is there a way I can ...
2
votes
2answers
38 views

Awk - keep word “example” and “EXAMPLE” with one input

I am attempting to to only keep customers that contain certain words. Here is an example < newname.txt awk 'BEGIN {FS=","} $7~/USA|United States/' > usa.txt The problem I am having is if they ...
-1
votes
2answers
50 views

can i do this or how can i do this awk + sort?

cat file_outunique.out | awk '{ print $1, $2}' | sort $2 -u > ledernier.out I want to output $1 and $2 for the 1st iteration of $2 Do you have any suggestions about this? I've tried to change ...
1
vote
3answers
78 views

awk manipulation of fasta file

I have a file like this >chr1 ACGTGGC TGCCGTT ATCCTTG >chr2 ACTTTTA CTCATAA I want to convert the seq into 1 string. This should be the output: >chr1 ACGTGGCTGCCGTTATCCTTG >chr2 ...
4
votes
3answers
106 views

How to insert multiple blank lines after every line

I want to insert 5 blank lines after every line in my input file. foo.txt: line 1 line 2 line 3 out.txt: line 1 line 2 line 3 ... Solaris 5.10, nawk or sed.
4
votes
4answers
506 views

How to insert all lines from one file to another file?

File1: .tid.setnr := 1123 .tid.setnr := 3345 .tid.setnr := 5431 .tid.setnr := 89323 File2: .tid.info := 12 .tid.info := 3 .tid.info := 44 .tid.info := 60 Output file: .tid.info := 12 ...
3
votes
1answer
54 views

Using awk to process a mapping file with dynamic number of columns

I'm a complete newbie to awk and am wondering how to process information as following: mapping.txt: 80 001 002 81 011 012 013 014 82 021 022 ... input.txt: 81 103823044 80 103823054 81 ...
3
votes
6answers
139 views

Case-insensitive count duplicate line, remove duplicate by choose case with highest duplicate

The duplicate is combination of different case text. I need to count number of duplicate (case-insensitive) and then I need to remove duplicate by choose case with highest duplicate. Below example: ...
3
votes
1answer
41 views

Sending signals to long-running processes (AWK, DD)

I'm familiar that DD command doesn't produce output while running. However, if I send a USR1 signal to it, it can print current state. Can I do the same with AWK? Prints its variables, register ...
3
votes
1answer
31 views

Match pattern, do calculation and print only 3 or 4 floating values max

I would like to convert below to GB and print only 3 floating values v copvol2 fsgen ENABLED 204800 - ACTIVE - - v copvol3 fsgen ENABLED 204800 - ...
0
votes
2answers
26 views

Unable to perform a simple multiplication in script

I am havingf trouble performing a simple multiplication in my script. while read A B C do tmp=$A\*$C/100 echo $tmp >> out1.txt done < foo.txt foo.txt: 13721725 99 100 ...
2
votes
4answers
90 views

Change text in tag, but only tag is contained within a certain XML block

Using Git Bash, I'm trying to conditionally replace what's in the yrot tag in hundreds of files, but only if it belongs with a part name tag that pertains to wheel. // YES, change <part ...
2
votes
5answers
120 views

Adjust gap between 2 columns to make them look straight

file1.txt: hi wonderful amazing sorry superman superhumanwith loss file2.txt : 1 2 3 4 5 6 7 When i try to combine using paste -d" " file1.txt file2.txt > actualout.txt actualout.txt : hi 1 ...
2
votes
1answer
27 views

Unset all ENV variables matching _PROXY

I'm trying to unset all environment variables that match _PROXY: env | grep -i _proxy | column -t -s '=' | awk '{ print $1 }' | grep -iv 'no_proxy' | xargs -0 -I variable unset variable but it's ...
0
votes
2answers
45 views

How to find and replace only a particular word (which is at the end of the file) using shell command?

File1: Dms 01.01.2015 feeder1 6kv close at 04:30 Updated Dms 01.01.2015 feeder1 6kv open at 06:20 Updated Dms 04.02.2015 feeder10 6kv close at 17:23 Updated Dms 04.02.2015 feeder12 6kv ...
4
votes
2answers
187 views

how to extract parts of file into separate files in linux using awk or grep or sed commands

I have text file as shown below: Input file1.txt ....................... cha21 1 3 5 nar cha21 2 3 6 piy cha23 2 3 5 ram cha23 3 ...
5
votes
8answers
635 views

How do I delete the first n lines and last line of a file using shell commands?

I have a file named Element_query containing the result of a query : SQL> select count (*) from element; [Output of the query which I want to keep in my file] SQL> spool off; I want to ...
1
vote
1answer
57 views

How to write data one by one from tmp files to the final output file using for loop?

I have two tmp files named tmp1 and tmp2 which contains some lines. tmp1 file, 1c\ datafile no. 23 2c\ datafile is ok tmp2 file, 3c\ datafile no. 24 4c\ datafile is ok I have a ...
0
votes
1answer
37 views

How to remove certain number of lines every time particular string is found in file

I want to remove 1 previous line and 10 following lines every time a string was found in the file. foo.txt: } Name: john Line 3 Line 4 Line 5 Line 6 Line 7 Line 8 Line 9 Line 10 Line 11 Line 12 ...
1
vote
2answers
48 views

How to print few lines from middle of a file using unix shell commands? [closed]

My file containing the following lines, $BQ { VOL @home } database daba relation tcdeatid opendb clear .lruno := 72 <-- (This line lruno. := 72 has 10 times ...
2
votes
3answers
37 views

Truncating the precision of a date

I'm working with a bash script which polls build progress from several different systems. If a build is complete, it stats a log file to find out the last time it was edited, then feeds that time into ...
1
vote
2answers
27 views

Addition of values

foo.txt: Lillypaul_sg 204803 204803 204803 Ammy_sg 3 ramaswamy_sg 3 33 tommy_sg 3 3 137374 100 Desired Out.txt : Lillypaul_sg 614409 Ammy_sg 3 ramaswamy_sg 36 tommy_sg 137480 The output is a sum ...
1
vote
3answers
72 views

Sed Replace at a specific group of positions

I have a sample input file as below: Apple Orange Gold Silver Spoon Apple Orange Gold Apple Apple Orange Apple Orange Mango Gold ...
3
votes
2answers
84 views

shell script to extract between characters

I would like to extract a user name from the file between the keywords "/" and "NET" like below. How can I do so with programs like awk, sed or cut. from: audit: command=true ...
3
votes
4answers
223 views

Extract paragraph separated with *** using AWK

I have a file like below: blablabla blablabla *** thingsIwantToRead1 thingsIwantToRead2 thingsIwantToRead3 blablabla blablabla I want to extract the paragraph with thingsIwantToRead. When I had to ...
0
votes
2answers
56 views

Count frequency of specific numbers in a text file of scientific notations

Background I have a text file, named blood_conc.txt as shown: 0, 0, 0, 0, 0, 0, 0, 1.32006590271e-05, 1.990014992001e-05, 1.504668143682e-05, 2.176900659261e-06, 7.673488970859e-06, ...
3
votes
2answers
896 views

Split log file by time range

I have a log file and would like to cut it into copies of 15min. In the log file the lines start with: dd mmm yyyy hh:mm:ss,xxx e.g. 12 Feb 2013 16:05:02,xxx log text... and the file rotates ...
-2
votes
4answers
61 views

How to print last few contents in a line?

I have a file that has lines shown below, ta=/*92/*39/*1/*649/*12 ta=/*92/*12/*4/*342/*90 ta=/*92/*33/*9/*455/*3 ta=/*92/*12/*3/*649/*25 ta=/*92/*99/*7/*649/*7 and so on. I want a file that will ...
3
votes
2answers
86 views

Check if conditional with awk for matches in logfile

I want to check the auth.log file for accepted sshd connections and execute an action if any are found. Here is my code: tail -f /var/log/auth.log | awk '{ if($0 ~ /sshd/ && $0 ~ /Accepted/) ...
0
votes
3answers
54 views

How do I pass a series of patterns into awk from a shell script?

I've got a series of patterns stored in foo.txt and I want to iterate over those patterns and see which match lines in file bar.txt. while read PWW do cat user/dump/bar.txt | awk '/${PWW}/{print ...
0
votes
1answer
36 views

How to integrate awk parameters in awk range pattern

I need to get something like this #Batch Job - AB1234 texts texts texts texts texts #-------- I used awk '/#Batch Job.*AB1234/,/#--.*/' filename and i went well. But then when I tried to ...
5
votes
3answers
152 views

Escape sequences passed as args to gawk not interpreted

I want to be able to pass an argument on the command line to gawk that is evaluated for escape sequences. The issue: $ gawk 'BEGIN { print ARGV[1]; }' '\t' \t Instead, I would like to get an ...