awk - pattern-directed scanning and processing language

learn more… | top users | synonyms

2
votes
3answers
171 views

how to create a data file with a column of date from day1 to dayN?

I was wondering if I could generate a hourly or daily time step date in a column starting from some year in the past to some day in the near past or today. to be more clear, I want to create one ...
10
votes
5answers
1k views

Using grep or awk

To capture a particular pattern, awk and grep can be used. Why should we use one over the other. How does this work in the background? Which is faster and why? E.g If I had a log file and I wanted ...
2
votes
3answers
491 views

sed - find string and append

Suppose you have the following text file 127.0.0.1 localhost localhost.localdomain localhost4 localhost4.localdomain4 ::1 localhost localhost.localdomain localhost6 localhost6.localdomain6 ...
1
vote
4answers
2k views

Finding out the common lines in two files using 4 fields using awk and UNIX

I have 2 files. If field 1, 2, 4 and 5 of both file1 and file2 matches, then I want to print the whole line of file1 and file2 one after another in my output file. File1: sc2/80 20 . ...
3
votes
3answers
4k views

importing data from a text file to a bash script

I need to import a text file like this below: AMBI CBNK CCXI CERE CLACW CNYD DAEG DLIA DLLR DNDN DSGX HAST HIBB, HPOL IRDMZ MARK NEPT NFEC NINE NRCIB OMER PLCC PLPM PSUN UNTK There are 25 entries, ...
4
votes
1answer
140 views

Looking for lines which is in one file but not in other using Unix and Awk

I have 2 files with 7 fields and I want to print the lines which are present in file1 but not in file2 based on field1 and field2. Logic: I want to print all the lines, where there is a particular ...
1
vote
6answers
4k views

Using cut/awk/sed with two different delimiters

I have the following cases: case@test.com case_1_2@test.com case_1@test.com I'm trying to convert these to case@test.com case@test.com case@test.com So it should remove everything from ...
2
votes
4answers
670 views

Can awk use field identifiers also for shell strings (variables)?

Well, this apparently is not possible the way I'm trying it. This alternate approach to obtain bar as a resulting string works, though: #!/bin/bash path1=/usr/tmp/foo/bar/baz awk -F/ '{print $5}' ...
3
votes
3answers
161 views

Easily get a particular column from output without sed or awk

Is there a quicker way of getting a couple of column of values than futzing with sed and awk? For instance, if I have the output of ls -hal / and I want to just get the file and directory names and ...
2
votes
1answer
1k views

Comparing Files based on 5 fields using Awk and Bash

I want to compare File1 and File2 (Separated by spaces) using five fields (Column 1,2,4,5,6). *Logic:*If column 1 and 2 of File1 and File2 match exactly and if the File2 has the same characters as ...
1
vote
3answers
462 views

How to limit MAX an MIN length of a string?

"nothing" means no OUTPUT. Q: how can I limit the MIN and MAX length of a piped STRING? (MIN: x>=3 chars, MAX: x<=32 chars) INPUT: echo 12 | MAGIC OUTPUT: nothing INPUT: echo 123 | ...
1
vote
1answer
53 views

How to make URL's out of this text with least resources?

INPUT: nyeeeeeeeeeeeeeee.txt:sadfsadf sadjflsajfd:jasdlfjalsfd foo/asdfsafd.txt:laksjdlfajsfd OUTPUT: <a href="nyeeeeeeeeeeeeeee.txt">nyeeeeeeeeeeeeeee.txt</a>:sadfsadf <a ...
1
vote
1answer
134 views

Searching for all the array elements in another array?

This is how I would search for an element in an array. count=${#ARRAY[@]} lsearch() { status=-1 for((i=0;i<count;i++)) do Temp=$1 if [[ $Temp -eq ${ARRAY[i]} ]] then ...
1
vote
1answer
692 views

How to integrate a multiline awk script in a shell script

I am a beginner in shell scripting and my question is a continuation of How to parse a file to extract 3 digits numbers kept in a "group number" I am trying to integrate in a single shell ...
4
votes
1answer
421 views

grep: display filename once, then display context with line numbers

Our source code has error codes scattered throughout. Finding them is easy with grep, but I'd like a bash function find_code that I can execute (eg. find_code ####) which will provide output along ...
5
votes
1answer
1k views

Sorting a file based on one column using Unix and Awk

I need to sort the input file according the 6th column, which is the score. Input File: Sc2/80 20 . A T 86 Pass N=2 F=5;U=4 Sc2/80 20 . A C 80 Pass N=2 F=5;U=4 Sc2/60 55 . G T 90 Pass N=2 F=5;U=4 ...
2
votes
3answers
96 views

Pulling out keywords using standard command line utilities?

As an example, this is the pronunciation of "when" according to Wiktionary. enPR, IPA and X-SAMPA are different schemes for showing pronunciations. when:* {{a|US}} {{enPR|wĕn|hwĕn}}, ...
0
votes
1answer
78 views

Splitting Apache Vhosts into Individual Files

I have several vhosts in one file that I am looking to break each into a file of their own corresponding to the ServerName. I'm looking to take this file <VirtualHost *:80> ServerName ...
3
votes
2answers
1k views

Removing unwanted lines in text file

All I need is the sed or awk code to remove the even numbered lines in a text file. Nothing fancy I just need to remove irrelevant data on the even lines of a text file.
3
votes
7answers
2k views

Problem in splitting a string using awk or cut command

I have a properties file which has a password field (key value pair) PASSWORD=NDhhHcsOBofXUdUzGw5B0Q== I am trying to get the value in my shell script using the awk command password=`awk -F "=" ...
2
votes
2answers
2k views

Comparing two files using Unix and Awk

I need to compare two files, File1 and File2 (Separated by space) using 4 fields (Field 1, 2, 4 and 5 of File 1 with field1, 2, 4 and 5 of File2). Logic: If column 1, 2 and 4 of File 1 matches with ...
2
votes
6answers
166 views

Bash - Split the previous commands parameters

How would one parse the previous command in bash? Example: root$ ssh foo@1.2.3.4 root$ echo !$ &>/tmp/foo.txt root$ cat /tmp/foo.txt foo@1.2.3.4 Goal: Send just the ipaddress 1.2.3.4 to ...
1
vote
3answers
151 views

Cat 2 files and avoid duplication of lines

I have the file1 with the following content {"name":"clio5", "value":"13"} {"name":"citroen_c4", "value":"23"} {"name":"citroen_c3", "value":"12"} {"name":"golf4", "value":"16"} {"name":"golf3", ...
1
vote
1answer
63 views

How to design the table in awk?

My input file is file1 count month 505 Apr-2010 252 Mar-2010 426 Feb-2010 201 Jan-2010 211 Dec-2009 Same file I want the output like this below +-------+----------+ | count | month ...
1
vote
1answer
86 views

Compare the similar file and not similar files display below output in awk?

I'd like to compare the following 2 files and display a comparison of the 2 files with each other. File #1: DATE DS 2012-08-02 1 2013-06-23 1 2013-06-27 2 2013-06-28 2 2013-06-29 779 File ...
1
vote
2answers
71 views

How to use AWK record separator?

Here is the input: * true, false, yes, no, always, never. * ******************************************************************************* default: su = true ... maxexpired = ...
1
vote
3answers
2k views

Count number of lines with a certain value in a column for all files in directory recursively

I have 40 files in a directory and I want to count the number of times there is a line with a "2" in the first column in each file individually. I am trying something like this, but it prints out ...
1
vote
2answers
208 views

Are there versions of Unix that don't have awk in default install?

Are there versions of Unix that don't have awk installed by default? I am fine with an answer containing some really old outdated Unix variant which predates awk's creation; but would ideally prefer ...
-1
votes
2answers
52 views

Line match to trigger specific argument

I have a file with 2 types of contents as below. QJKLJFLHLKJDGFIUD 03:12:23 JHKJFDGDSFGDFGHDF 03:15:45 HJIK ASDSdSADSADSSADSA 03:30:34 DFDF KWQA I have 2 binaries. One is on the local ...
4
votes
3answers
193 views

Check for, and add, missing timestamps to individual lines in a file

I have a file in the following format: ABCD 01206001022T01YA022T01YA022T07SO 09:20:38 ABCD 01206001022ACION 09:24:40 ABCD 04006001021S01UK 09:24:42 ABCD 7878696621321312 23213213213213 ABCD ...
2
votes
6answers
3k views

Repeat each line multiple times

Would like to have each line in a file repeated a fixed number of times. e.g. have each line repeated four times: a b c becomes: a a a a b b b b c c c c I've done some searching, and there are ...
1
vote
5answers
410 views

delete lines in a csv file older than 7 days

I have a csv that I need to remove all lines that are older than 7 days. This is the format of the csv Person ID VIP CS SS LT FTLT PS Modified Datestamp T001028 1 1 1 0 0 0 ...
2
votes
4answers
1k views

Split long output into two columns

Is there a simple utility or script to columnate the output from one of my scripts? I have data in some form: A aldkhasdfljhaf B klajsdfhalsdfh C salkjsdjkladdag D lseuiorlhisnflkc E sdjklfhnslkdfhn ...
9
votes
8answers
2k views

How to remove multiple newlines at EOF?

I have files that end in one or more newlines and should end in only one newline. How can I do that with Bash/Unix/GNU tools? Example bad file: 1\n \n 2\n \n \n 3\n \n \n \n Example corrected ...
-1
votes
2answers
1k views

How can I print unique line base on particular column value using awk? [closed]

I have a comma separated file with multiple fields. Example: candidate1,12,56,ATTG candidate2,45,90,ATTG candidate3,90,140,ATTG candidate4,2,36,AGCT So, does anyone know the answer?
0
votes
4answers
3k views

Extract substring using regular expression on a Unix file

I have file with below contents . /ABC/RTE/AD_900_VOP_123/OPP /ABC/RTE/TRE/AD_900_VOP_145/BBB /ABC/RTE/AN_900_VFP_124/FBF /ABC/RTE/HD_900_FOP_153/WEW /ABD/RDV/AD_900_VOP_123/OPP ...
1
vote
2answers
679 views

Use FOR Loop inside END block of awk command

I'm trying to find the average number of files per day. The following script works: #!/bin/sh ls -l | grep "^-" | awk '{ key=$6$7 freq[key]++ } END { for (date in freq) printf ...
4
votes
3answers
853 views

Change the text on a single line number in multiple text files

Suppose that I have ten bash shell scripts: script1.sh, script2.sh, ..., script10.sh. Initially, all ten files are identical. Now, I would like to make two changes in each script: In each file, ...
1
vote
1answer
315 views

awk can't print array element

Lets sat my file1 is: A S B Q file2 is: B 2 I want to match $1 from file2 with $1 file1 and print file1 $2 && file2 $2, for the output like this: Q 2 My awk solution ...
2
votes
2answers
89 views

Print line n-1 (and n) if line n fulfills condition

I have a fasta file looking something like this: >19 dna:chromosome chromosome:NCBIM37:19:1:61342430:1 37330562 ID13406 U - TACATGGGTGACAAGGAGGTCAGGTGTTA >19 dna:chromosome ...
5
votes
1answer
2k views

Removing leading zeros from DATE

I made an alias of the date command to display date in the following format: 2013.06.14.12.10.02 using this command: alias date = date +"%Y.%m.%d.%H.%M.%S" Everything works great, except I ...
1
vote
2answers
91 views

Grep and sort several unsorted things in several lines (in one document)

I have a file with several unsorted things in one line which I want to put into a new file This is an example of part of the file I have: X1314448: SaMi|SM_g2554.t1 SaMi|SM_g5072.t1 Des|Des_g3808.t1 ...
4
votes
2answers
372 views

Use sed or awk to join lines in a certain pattern?

Not sure on how to turn this input: A B C apartner bpartner cpartner into this output: A apartner B bpartner c cpartner I have this pattern in a 80 line file that needs to be 40 line. Also, how ...
4
votes
2answers
172 views

AWK - a question about columns

I have a question. I was trying to deal with it by myself, but it seems like I am too new in awk to make it work. Let's assume that we have a file (eg. database.txt) (values are tab-separated): ...
2
votes
3answers
135 views

Delete lines containing repeated text

I have a file containing two paths on each line. I want to remove the lines containing the same path twice. I work on Linux and Solaris. I would like a one-liner in sed or awk or perl. Example input ...
2
votes
3answers
899 views

I want to find duplicates in a file and add a character to the end of the line on the 1st match

I am trying to find duplicates in a file and once a match is found mark the 1st match with a character or word on the end of the line. eg my file (test.html) contains the following entries host= ...
2
votes
2answers
2k views

Replacing text between two HTML Comments

I am new to the world of sed/awk and regex in general and have been studying their usage, but have been floundering trying to meet my need: I have an htm page that has a single line notice that needs ...
2
votes
3answers
194 views

Text to yaml conversion

I have a tab separated text file in this format: your-email your-order-id PayPal-transaction-id your-first-name your-second-name s@ess.com 12345 54321 sooky spooky t@tee.com 23456 ...
4
votes
2answers
807 views

Inotifywait for large number of files in a directory

What I want to do is, to monitor a directory (not recursive, just one) for new files created and append those files to one single big file as they are being written. The number of files that are ...
2
votes
3answers
2k views

Easy way to parse syslog date format

I'd like to write a script that analyses the last week's syslog. But my syslog logs in a stupid date format, e.g. "May 22". If it logged as 2013-05-22, this task would be trivial. Is there a way ...